ID: 1045017363

View in Genome Browser
Species Human (GRCh38)
Location 8:98010899-98010921
Sequence GCCTAGGCCTGCCTCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 755
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 709}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045017363_1045017370 8 Left 1045017363 8:98010899-98010921 CCAGGGCTGAGGCAGGCCTAGGC 0: 1
1: 0
2: 4
3: 41
4: 709
Right 1045017370 8:98010930-98010952 GGGAGTGTCTTAGTCTACTCGGG No data
1045017363_1045017369 7 Left 1045017363 8:98010899-98010921 CCAGGGCTGAGGCAGGCCTAGGC 0: 1
1: 0
2: 4
3: 41
4: 709
Right 1045017369 8:98010929-98010951 GGGGAGTGTCTTAGTCTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045017363 Original CRISPR GCCTAGGCCTGCCTCAGCCC TGG (reversed) Intronic
900208933 1:1444077-1444099 GCCTTGGCCTCCCTCAGTGCTGG + Intergenic
900299055 1:1967647-1967669 GCCTTGGGCTGCCTCAGCTTTGG - Intronic
900432248 1:2607866-2607888 GCCGGGGCCTGCCTCATCACAGG - Intronic
900779958 1:4611665-4611687 GTGTGGGGCTGCCTCAGCCCCGG - Intergenic
900819194 1:4873241-4873263 GCCCAGGGCTGCGTCAACCCAGG - Intergenic
901275466 1:7987655-7987677 GCCTCGGCCTCCCACAGTCCTGG + Intergenic
902656376 1:17871605-17871627 GCCTAGGCCTCCCAAAGTCCTGG + Intergenic
903124158 1:21236398-21236420 GCCTTGGCCTGCCAAAGCGCTGG - Intronic
903391202 1:22964705-22964727 GCCTAGGCTTTGCTCAGCCTGGG + Intronic
904085463 1:27903816-27903838 GCCTAGGCTGGCCTCAAACCTGG - Intronic
904160291 1:28518123-28518145 GCCAAGGGCTCCCCCAGCCCGGG + Intronic
904400851 1:30255565-30255587 GCCGAGGCCATCCTCATCCCAGG + Intergenic
904454267 1:30637817-30637839 GCCAAGGCCGTCCTCACCCCGGG + Intergenic
905035645 1:34916605-34916627 GCCTAGGCCTTGGTCAGGCCTGG - Intronic
905182932 1:36177925-36177947 GCCTCCCCCTGCCCCAGCCCAGG + Exonic
905300016 1:36980609-36980631 GCCCAGGCCTGCAGCATCCCAGG - Intronic
905644485 1:39615837-39615859 GCCTCGGCCTCCCTCAGTGCTGG + Intergenic
907072416 1:51548637-51548659 GCCTCGACCTCCCTCAGTCCTGG + Intergenic
907241105 1:53081564-53081586 GCCCTGGCCTGGCTCAGCGCTGG + Intronic
907383383 1:54109725-54109747 GCCAAGCCCTCCCTCAGCCATGG + Intronic
907404199 1:54243750-54243772 GCCTGGGCCTGCACCAGCCTCGG - Intronic
907463429 1:54619828-54619850 GCCCTGGCCTGCCTCAGTCTTGG + Intronic
907931932 1:59008718-59008740 GCCTGGGCCACCCTGAGCCCTGG - Intergenic
908182977 1:61624454-61624476 GCCTTGGCCTCCCACAGTCCTGG + Intergenic
909073884 1:71029674-71029696 GCCTAGGCCTGCCAAAGTACTGG - Intronic
909082306 1:71127298-71127320 GCTTTGGAGTGCCTCAGCCCAGG + Intergenic
910288140 1:85576864-85576886 GCCCAGGCCTCCCTCCGCGCGGG - Intronic
910488062 1:87737864-87737886 GCCTAGGCCTCCCAAAGTCCTGG - Intergenic
910965921 1:92807788-92807810 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
911647284 1:100350941-100350963 GCCTTGGCCTGCCACAGCGCTGG - Intergenic
911710078 1:101061634-101061656 GCCTAGGCCTCCCAAAGCACTGG + Intergenic
912439948 1:109690186-109690208 GCCTGGGCCGTCCACAGCCCCGG + Intronic
912705959 1:111912674-111912696 GCCTAGGCCTGCATCAGGTTAGG - Intronic
912936923 1:114011787-114011809 GCCTTGGCCTCCCACAGCCCTGG + Intergenic
913317996 1:117568362-117568384 ACCCAGGCCTGCCTGAGCTCAGG - Intergenic
914361721 1:146941504-146941526 GCCTAGGCCTCCCACAGTGCTGG - Intronic
914489902 1:148145457-148145479 GCCTAGGCCTCCCACAGTGCTGG + Intronic
914731983 1:150379649-150379671 GCCTCGGCCTCCCTAAGCACTGG + Intronic
914997138 1:152553738-152553760 GCCTCGCCCTGCTTCAGCTCAGG + Intronic
915275079 1:154782961-154782983 GCCTCGGCCTGCCAAAGCGCTGG - Intronic
915734309 1:158075123-158075145 GCCTAGGCCTGCCCCACCACTGG + Intronic
916335336 1:163664802-163664824 GCCTGGGGCTGCCCCAGCTCTGG + Intergenic
917117359 1:171615966-171615988 GCCTCGGCCTCCCAAAGCCCTGG - Intergenic
918109166 1:181440752-181440774 GCCTTGGATTGCCTGAGCCCAGG + Intronic
920192237 1:204201105-204201127 GGCCAGGCCTGTGTCAGCCCTGG - Intronic
922481840 1:225944753-225944775 GGCCTGGCCTCCCTCAGCCCTGG - Intergenic
923093083 1:230754093-230754115 CCCCCAGCCTGCCTCAGCCCTGG - Intronic
923168608 1:231392036-231392058 GCCTAGGCCTCCCAAAGCGCTGG - Intronic
923177277 1:231478953-231478975 GCCTAGGCCTCCCAAAGTCCTGG + Intergenic
923538522 1:234871425-234871447 CCCTCTGCCTGCCTCAGCCGGGG + Intergenic
923928195 1:238659818-238659840 GCCTAGGCCTGCCAAAGTGCTGG + Intergenic
924532242 1:244903319-244903341 GCCTAGGCCTACCAAAGTCCTGG - Intergenic
924823751 1:247518737-247518759 GCCTTGGCCTGCCAAAGCGCTGG - Intronic
1063337397 10:5229170-5229192 ACCTGGACCTGCCTCAGACCCGG - Intergenic
1064045517 10:12011237-12011259 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1064057950 10:12113674-12113696 GCCTAGGCCTCCCAAAGTCCTGG - Intronic
1064119358 10:12605729-12605751 GCCCAGCTCTGCCTCAGCCCTGG + Intronic
1064273381 10:13885133-13885155 GCCTTGGCCTCCCCAAGCCCTGG - Intronic
1065097208 10:22293307-22293329 GCCTCGGCCTGCCAAAGTCCTGG + Intergenic
1065141098 10:22718884-22718906 GCCTTGGCCTGCCAAAGCTCTGG - Intergenic
1065224299 10:23527269-23527291 GCCTAGGCCTTCCAAAGTCCTGG - Intergenic
1065351998 10:24804110-24804132 GCCTAGGCCTGCCAAAGTGCTGG + Intergenic
1065667904 10:28082716-28082738 GCCTCAGCCTCCCTCAGCGCTGG + Intronic
1065751172 10:28889162-28889184 GCCTTGGCCTCCCTCAGTGCTGG + Intergenic
1066133050 10:32413348-32413370 GCCTAGGCCTCCCAAAGCACTGG + Intergenic
1066759253 10:38738207-38738229 GCCCTGCCCTGACTCAGCCCTGG + Intergenic
1066962370 10:42234561-42234583 GCCCTGCCCTGACTCAGCCCTGG - Intergenic
1067002262 10:42627251-42627273 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1067031514 10:42880921-42880943 CCCTTGGGCTGGCTCAGCCCAGG - Intergenic
1067051945 10:43026685-43026707 GCCTTGTCCTGCGTCTGCCCCGG - Intergenic
1067457142 10:46427182-46427204 GCCTGGGCCTGACTGAGGCCGGG + Intergenic
1067630059 10:47957456-47957478 GCCTGGGCCTGACTGAGGCCGGG - Intergenic
1068481284 10:57591458-57591480 GCCTTGGCCTGCCTAAGTGCTGG - Intergenic
1069447828 10:68490178-68490200 GCCTTGACCTCCCTCAGCTCAGG - Intronic
1069859462 10:71461401-71461423 GCCTAAGGCTGTCACAGCCCAGG - Intronic
1070317224 10:75325971-75325993 GCCTTGGCCTCCCTCAGTGCTGG + Intergenic
1070754804 10:78985448-78985470 GCCCAGGCCTGCCTTTCCCCTGG + Intergenic
1071072163 10:81706838-81706860 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
1071515024 10:86291489-86291511 TACCAGCCCTGCCTCAGCCCAGG + Intronic
1072080005 10:92019969-92019991 ACCTGGGCCTGCCAAAGCCCTGG + Intronic
1072117459 10:92377513-92377535 GCCTTGGCCTGCCACAGTGCTGG - Intergenic
1072619977 10:97073458-97073480 GCCAGGGCCTGTCCCAGCCCGGG + Intronic
1072621561 10:97082994-97083016 GCCCAGGATTGCCTGAGCCCAGG - Intronic
1073210387 10:101796507-101796529 GCCTAGGCCTCCCTAAGTGCTGG + Intronic
1073358335 10:102875225-102875247 GCCTCGGCCTCCCACAGCACTGG - Intronic
1073485762 10:103818230-103818252 TCCCTGGGCTGCCTCAGCCCTGG + Intronic
1074409317 10:113211512-113211534 GCCTTGGCCTCCCACAGCACTGG + Intergenic
1075050670 10:119181215-119181237 GCCTTGGCCTCCCACAGCGCTGG + Intergenic
1075078739 10:119368787-119368809 GCCCAGCCTTGCCTCCGCCCAGG + Intronic
1075309889 10:121405235-121405257 GGCCAGGCAAGCCTCAGCCCTGG - Intergenic
1075511273 10:123074529-123074551 TCCTTGGCCTGCCTCAACCATGG - Intergenic
1075545635 10:123352328-123352350 GCCTGGGCCTCCCTCTGGCCAGG + Intergenic
1075592374 10:123702288-123702310 GCCTAGGCCTCCCAAAGCACTGG + Intergenic
1075633684 10:124016294-124016316 TCCCAGCCCTGCCACAGCCCTGG - Intronic
1075671063 10:124264461-124264483 GCCTGGGGCTGTCTCTGCCCTGG + Intergenic
1075973721 10:126676636-126676658 GCCTCGCCCTGCTTCAGCTCGGG - Intergenic
1076046055 10:127295006-127295028 ACCTAGGCCTCCCAAAGCCCTGG - Intronic
1076737758 10:132466309-132466331 GCCAAGGCCTGGTTCAGGCCAGG + Intergenic
1076924517 10:133475721-133475743 GCCCAGGCAGTCCTCAGCCCAGG - Intergenic
1076924535 10:133475772-133475794 GCCCAGGCAGCCCTCAGCCCAGG - Intergenic
1076924539 10:133475788-133475810 GCCCAGGCAGTCCTCAGCCCAGG - Intergenic
1076924552 10:133475822-133475844 GCCCAGGCAGCCCTCAGCCCAGG - Intergenic
1076924564 10:133475856-133475878 GCCCAGGCAGTCCTCAGCCCAGG - Intergenic
1076924581 10:133475907-133475929 GCCCAGGCAGTCCTCAGCCCAGG - Intergenic
1076924585 10:133475923-133475945 GCCCAGGCAGTCCTCAGCCCAGG - Intergenic
1077026793 11:443282-443304 GCCTCGGCCTGCCAAAGCGCCGG - Intergenic
1077042631 11:531335-531357 GCCTGGCCCAGCCTCAACCCGGG + Intergenic
1078076941 11:8170774-8170796 GCCTTGGCCTCCCAAAGCCCTGG - Intergenic
1078527290 11:12110676-12110698 GGTCAGGCCTGCCTCGGCCCTGG - Exonic
1079241090 11:18722400-18722422 GGCTAGGCCTGCTTCTGCCTGGG + Intronic
1079250043 11:18780559-18780581 TCCAAGGCCCACCTCAGCCCAGG + Intronic
1079941733 11:26689144-26689166 GCCTAGGCCTCCCTAAGTGCTGG - Intronic
1080583194 11:33660005-33660027 CACTAGGCCTGCATCTGCCCAGG - Intronic
1081302494 11:41469303-41469325 GCCTAGACCTACCTGAGCTCAGG - Intergenic
1082238439 11:49848997-49849019 GCCTTGGCCTGCCAAAGCACTGG - Intergenic
1082282332 11:50283196-50283218 GCCTCGGCCTCCCACAGTCCTGG - Intergenic
1082658189 11:55876153-55876175 GCCTTGGCCTGCCAAAGCACTGG + Intergenic
1083322362 11:61855491-61855513 TCCATGGCCGGCCTCAGCCCTGG + Intronic
1083741907 11:64715732-64715754 TCCAAGGACTGCCTCTGCCCGGG + Intronic
1083835982 11:65268040-65268062 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
1083840078 11:65299330-65299352 CCCTTGCCCTGCCTCTGCCCTGG + Intronic
1084054348 11:66622481-66622503 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1084063487 11:66690331-66690353 GCCGCAGCCTGCCTCAGTCCTGG + Intronic
1084114404 11:67033393-67033415 GCCTGGGGCTGACTCAACCCTGG + Intronic
1084171426 11:67402813-67402835 GCCTAGGCCTCCCAAAGTCCTGG - Intronic
1084273741 11:68041666-68041688 GCCCAGGCCTGACTCTCCCCAGG - Intronic
1084412169 11:69011404-69011426 GCCTACGGCTGACTCAGCCTGGG + Intronic
1084432372 11:69118313-69118335 GCCTTGGCCTACCAAAGCCCTGG + Intergenic
1084921732 11:72476282-72476304 GCCTAGGCCTCTCACAGCCGTGG + Intergenic
1084937029 11:72592346-72592368 GCCAATGCCTGCCTCAGCTCTGG + Intronic
1085032911 11:73283480-73283502 CCCTAGCCCTGCACCAGCCCTGG + Intronic
1085213829 11:74809568-74809590 GCCTAGGCCTCCCTAAGTGCTGG - Intronic
1085471863 11:76763620-76763642 AGCTATGCCTGCCTCAGCCTGGG - Intergenic
1085626613 11:78078838-78078860 GCCTCAGCCTCCCTCAGCCTGGG + Intronic
1086731529 11:90256437-90256459 GCTGCGACCTGCCTCAGCCCCGG - Intergenic
1086818603 11:91406127-91406149 GCCTGGGCCTTGCTCAGCTCTGG + Intergenic
1086832968 11:91587983-91588005 GCCTTGGCCTGCCAAAGTCCTGG + Intergenic
1086997614 11:93376191-93376213 GCCTTGGCCTGCCAAAGCGCTGG + Intronic
1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG + Intergenic
1089809607 11:121120977-121120999 GCCAAGGCCAGCTACAGCCCAGG - Intronic
1090668455 11:128930494-128930516 CCCTAGGCCTCCCTAACCCCCGG - Intergenic
1090668487 11:128930572-128930594 CCCTAGGCCTCCCTAACCCCTGG - Intergenic
1091277249 11:134360902-134360924 GCCTCGGCCTCCCACAGCGCTGG - Intronic
1091574602 12:1721463-1721485 GCCTTGGCCTGCCACAGTGCTGG + Intronic
1091719157 12:2800024-2800046 TCCTTGGCCTGCCACACCCCAGG - Exonic
1092847191 12:12594871-12594893 GCCTTGGCCTCCCTCAGTGCTGG - Intergenic
1093153861 12:15656648-15656670 GCCAAGGACTGCTTGAGCCCTGG - Intronic
1093207471 12:16267983-16268005 GCCTAGGCCTCCCAGAGCCCAGG + Intronic
1094096400 12:26709987-26710009 GCCTCGGCCTCCCAAAGCCCTGG - Intronic
1096103083 12:48981025-48981047 GCCCAGGCCTAGCTGAGCCCAGG - Intronic
1096114931 12:49050251-49050273 CCCCAGCCCTGCCCCAGCCCTGG - Exonic
1096125344 12:49115196-49115218 GCCTCGGCCTGCCAGAGCACTGG - Intergenic
1097160604 12:57044076-57044098 GCCCAAGCCTGCCTCACCCTGGG + Intronic
1098964097 12:76767668-76767690 GCCTCGGCCTCCCTAAACCCTGG - Intronic
1102245391 12:111352711-111352733 GCCCAGGCCCCCATCAGCCCTGG + Intergenic
1102342117 12:112129889-112129911 GCCTCGGCCTCCCTAAGTCCTGG + Intronic
1102721535 12:115020800-115020822 TCCTATGCCAGCCCCAGCCCAGG - Intergenic
1103829844 12:123769989-123770011 GCCTTGGCCTCCCTAAGTCCTGG - Intronic
1104856098 12:131903173-131903195 GCCTGGGCCTGCAGCTGCCCTGG + Intronic
1104896786 12:132168689-132168711 GCCAGGGACAGCCTCAGCCCCGG - Intergenic
1105377409 13:19858333-19858355 GCCTAGGCCTCCCAAAGCGCTGG - Intronic
1105571012 13:21603219-21603241 GCCTCGGCCTCCCAAAGCCCTGG + Intronic
1105728434 13:23187677-23187699 CCCTCTGCCTGCCTCATCCCTGG + Intronic
1106682986 13:32027519-32027541 GCATGGGTCTGCATCAGCCCAGG - Intergenic
1107173895 13:37377718-37377740 ACCTAGGCATGCTTCAGCCTAGG - Intergenic
1107411284 13:40160813-40160835 TCATAGGCCTGCCTCTGTCCAGG - Intergenic
1108454777 13:50602106-50602128 ACCTAGGCCTCCCAAAGCCCTGG + Intronic
1108683349 13:52798205-52798227 AGCTTTGCCTGCCTCAGCCCAGG - Intergenic
1109442820 13:62397629-62397651 GCCCAGGCCAGCCACAGCCTGGG - Intergenic
1109672469 13:65627165-65627187 GCCTAGGCCTCCCAAAGCACAGG - Intergenic
1110879916 13:80559067-80559089 GCCTAGGCCTCCCTAAGTGCTGG + Intergenic
1111213219 13:85108423-85108445 GCCTGGGCCTCAGTCAGCCCTGG + Intergenic
1111310055 13:86472597-86472619 GCCTAGGCCTCCCAAAGCGCTGG - Intergenic
1112091593 13:96090032-96090054 GCCAAAGCCTCCCCCAGCCCCGG - Intergenic
1112109316 13:96277062-96277084 GCCCAGTCCTGCTTCAGCCTGGG + Intronic
1112168913 13:96949035-96949057 GCCTTGGCCTCCCTAAGCGCTGG - Intergenic
1112595596 13:100804387-100804409 GCCTCGGCCTCCCACAGCGCTGG + Intergenic
1112711202 13:102130818-102130840 GGACAGGCCTCCCTCAGCCCAGG + Intronic
1113910164 13:113837903-113837925 GCCCAGGCCAGCCGCAGCACAGG - Intronic
1115594720 14:34898219-34898241 GCCTCGGCCTCCCTAAGCTCTGG + Intergenic
1115650367 14:35398720-35398742 GCCTTGGCCTCCCACAGTCCTGG - Intergenic
1116555994 14:46308318-46308340 GCCTTGGCCTTCCACAGCGCTGG - Intergenic
1116966883 14:51024224-51024246 CCCCAGGCTTGCCTCTGCCCGGG - Intronic
1117276108 14:54195460-54195482 GCCTTGGCCTGCCACAGTGCTGG - Intergenic
1118307154 14:64664503-64664525 GCCTAGGCCTGCCTAGGGTCAGG + Intergenic
1118612351 14:67551637-67551659 GCCTCGGCCTCCCTAAGTCCTGG - Intronic
1118710193 14:68512562-68512584 GCCTAAGCCCACCTCTGCCCTGG + Intronic
1118849646 14:69573859-69573881 GCCTGGGTCTCCCTCAGCCCCGG + Intronic
1119482380 14:74966182-74966204 GCATAGGCCTTCCCCAGCACGGG - Intergenic
1119539269 14:75428124-75428146 GCCCAGGCCTGTCCCGGCCCGGG - Intronic
1119648361 14:76365223-76365245 GCCTAGGCCTCCCACAGTGCTGG - Intronic
1119735731 14:76980616-76980638 GGCTGGGCCTGCCTGACCCCAGG - Intergenic
1119808196 14:77496532-77496554 GCCTAGGCCTCCCTAAGTGCTGG - Intronic
1119993551 14:79227065-79227087 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
1120668519 14:87336301-87336323 TGCTAGGACTCCCTCAGCCCTGG + Intergenic
1121035540 14:90700337-90700359 ATCTAGGCTGGCCTCAGCCCTGG - Intronic
1121347193 14:93144818-93144840 GCCTAGGCCTTCCACAGTGCTGG + Intergenic
1121649748 14:95549248-95549270 GCCTGGGCCTCCCAAAGCCCTGG + Intergenic
1121743392 14:96269315-96269337 GCCAAGGCTTGGATCAGCCCTGG - Intergenic
1121767776 14:96502481-96502503 GGGGGGGCCTGCCTCAGCCCTGG - Exonic
1122492308 14:102126775-102126797 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
1122551898 14:102555024-102555046 GCCCAGGCCAGCGCCAGCCCAGG + Intergenic
1122826737 14:104374309-104374331 GACTCAGCCTGCCTCACCCCAGG + Intergenic
1122864110 14:104595796-104595818 GCCCAGGCCTGGCTCACTCCTGG - Intronic
1122901910 14:104785521-104785543 GCCTGGGCCTCGCCCAGCCCAGG + Intronic
1122963414 14:105110694-105110716 GCCTTGGCCTGCCACAGTGCTGG + Intergenic
1123422308 15:20143408-20143430 GCCCTGCCCTGACTCAGCCCTGG - Intergenic
1123531536 15:21149948-21149970 GCCCTGCCCTGACTCAGCCCTGG - Intergenic
1123715319 15:23025149-23025171 GCCTTGGCCTCCCACAGCACTGG + Intronic
1123950999 15:25274635-25274657 GCCTTGGCCTCCCAAAGCCCTGG + Intergenic
1124020484 15:25917859-25917881 GCCTAGGCCTCCCAAAGTCCTGG - Intergenic
1124547401 15:30643524-30643546 GCCTAGGCCTGCCAAAGTGCTGG + Intronic
1125107595 15:35991571-35991593 GCCTTGGCCTGCCTGAACCTTGG - Intergenic
1125543444 15:40486224-40486246 GCCTAGGCCTCCCACATCGCTGG + Intergenic
1125645416 15:41268395-41268417 GCCTCAGCCTGCCAAAGCCCTGG - Intronic
1125725714 15:41867161-41867183 GCCAGGCCCTGCCCCAGCCCAGG - Intronic
1125957408 15:43799955-43799977 GCCAAGGCCGGCCCCAGCCCCGG - Exonic
1127207155 15:56733204-56733226 GCCCAGGCCTGCAGCAGCCGAGG + Intronic
1127273997 15:57426392-57426414 GCCTAGGCCTCCCAAAGCGCTGG + Intronic
1128209009 15:65879259-65879281 GCCTTGGCCTGCCAAAGTCCTGG + Intronic
1128404547 15:67322571-67322593 CCCTGGGCCTTGCTCAGCCCTGG + Intronic
1128406878 15:67350673-67350695 GCCTAGGCCTCCCACAGTGCTGG + Intronic
1128796259 15:70468921-70468943 GGCTGGGCCTGCGTCTGCCCAGG + Intergenic
1128926727 15:71662997-71663019 GCCTTGGCCTCCCACAGCGCTGG - Intronic
1128938784 15:71769995-71770017 GCCTTGGCCTGCCACAGTGCTGG - Intronic
1129694083 15:77730814-77730836 GCCCATGCCTCCCTCAGGCCTGG + Intronic
1129712556 15:77827896-77827918 GGCCAGGCCTGCCTCATTCCAGG - Intergenic
1130209781 15:81912480-81912502 GCCCAGGGCTGACCCAGCCCAGG + Intergenic
1130948260 15:88565759-88565781 GCCCAGGGCTGCATCAGCCAAGG + Intergenic
1131125782 15:89855597-89855619 GCCTTGGCCTGCCACAGTGCTGG - Intronic
1131275282 15:90975329-90975351 GCCTCGGCCTCCCAAAGCCCTGG + Intronic
1132181195 15:99754086-99754108 GCCCAGGCCTGCCTCTGCTAGGG - Intergenic
1132250065 15:100329287-100329309 GCCTTGGCCTGCCAAAGTCCTGG - Intronic
1132357638 15:101184597-101184619 GCCTCGGCCTCCCAAAGCCCTGG + Intronic
1132515121 16:362674-362696 GCCTTGGGCTGCTGCAGCCCAGG + Intergenic
1132735711 16:1384846-1384868 GCCTCGGCCTCCCACAGCGCTGG + Intronic
1133295165 16:4748298-4748320 GCCTAGGCCTTCCACAGTGCTGG + Exonic
1133562445 16:6962613-6962635 GCCTCGGCCTCCCAAAGCCCTGG - Intronic
1133986221 16:10670275-10670297 GCCTTGGCCTGCCACAGTGCTGG - Intronic
1134092847 16:11400688-11400710 GCCTCGGCCTCCCTCAGTGCTGG + Intronic
1134180513 16:12044001-12044023 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
1136376912 16:29871296-29871318 CCCTAGGCCTGACTCCGGCCAGG - Exonic
1136507932 16:30718120-30718142 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1136561112 16:31039838-31039860 CCCCTGGCCTGCCCCAGCCCTGG + Intronic
1136723537 16:32340978-32341000 GCCCTGCCCTGACTCAGCCCTGG - Intergenic
1136776244 16:32873359-32873381 GGCCAGGCCTGGCACAGCCCTGG + Intergenic
1136841868 16:33547023-33547045 GCCCTGCCCTGACTCAGCCCTGG - Intergenic
1136862447 16:33711941-33711963 GCCCTGCCCTGACTCAGCCCTGG + Intergenic
1136894371 16:33988153-33988175 GGCCAGGCCTGGCACAGCCCTGG - Intergenic
1137525684 16:49234286-49234308 GCCTAGGCCTCCCAAAGCACTGG - Intergenic
1137675196 16:50300670-50300692 CCCCAGCCCTGCCTAAGCCCTGG - Intronic
1137793634 16:51196367-51196389 CCCTGGACCTCCCTCAGCCCCGG - Intergenic
1138125005 16:54431489-54431511 GCCTGGGTCAGCCTCAGTCCCGG - Intergenic
1138413087 16:56854906-56854928 GCCTAGGCCTCCCTAAGTGCTGG - Intergenic
1138556849 16:57775829-57775851 GCCTGGTCCGTCCTCAGCCCTGG - Intronic
1138688177 16:58744815-58744837 GCCTAGGCCTGCCAAAGTGCTGG - Intergenic
1139408436 16:66738625-66738647 GCCTTGGCCTGCCACAGTTCTGG - Intronic
1139475765 16:67201897-67201919 CCCCACCCCTGCCTCAGCCCAGG + Intronic
1139825149 16:69751255-69751277 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1139971769 16:70780834-70780856 GGCTCTGCCTGCCTCTGCCCAGG + Exonic
1141077652 16:81022006-81022028 GCCTTGGCCTGCCAAAGCGCTGG + Intronic
1141624273 16:85253199-85253221 GCCAAGGCCTGCCTCGCCGCCGG + Intergenic
1141867472 16:86760731-86760753 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
1141922138 16:87143463-87143485 CCCCAGGCCTGCCTCAGCCACGG + Intronic
1142345344 16:89550420-89550442 GCCTTGGCCTCCCACAGCGCTGG + Intronic
1203002895 16_KI270728v1_random:176787-176809 GCCCTGCCCTGACTCAGCCCTGG + Intergenic
1203078659 16_KI270728v1_random:1135468-1135490 GGCCAGGCCTGGCACAGCCCTGG + Intergenic
1203123941 16_KI270728v1_random:1560124-1560146 GCCCTGCCCTGACTCAGCCCTGG + Intergenic
1203134500 16_KI270728v1_random:1713193-1713215 GCCCTGCCCTGACTCAGCCCTGG + Intergenic
1203152033 16_KI270728v1_random:1847320-1847342 GCCCTGCCCTGACTCAGCCCTGG - Intergenic
1142579544 17:932895-932917 GCCTCGGCCTCCCTCAGTACTGG + Intronic
1142633789 17:1243805-1243827 GCCTCGGCCTGCCATAGCGCTGG - Intergenic
1142672021 17:1491754-1491776 GCCCCGCCCCGCCTCAGCCCCGG + Intronic
1142970647 17:3609393-3609415 GGCCAGGCCTGCCTGAGCCTGGG + Exonic
1143260701 17:5596324-5596346 TCCTAGACCAGCCTCTGCCCTGG + Intronic
1143837154 17:9701560-9701582 GCCCAGTCCTGCCTCAGGGCTGG - Exonic
1143972614 17:10806340-10806362 GTCCACGCCTGCCTCCGCCCAGG - Intergenic
1144849781 17:18238258-18238280 GCCTTGGCCTGGCTCTGGCCTGG + Intronic
1144850871 17:18243354-18243376 GCCTCGGCCTCCCTAAGTCCTGG + Intronic
1144871682 17:18376022-18376044 GCCAACGCCAGCCTCACCCCTGG - Intergenic
1144887973 17:18476913-18476935 GCACAGGGCTGCCTCAGCCAGGG + Intronic
1144950692 17:18992046-18992068 GCCTGCGCCTGCCCCAGCCCAGG + Intronic
1145126015 17:20300698-20300720 GCCCAGGCCTCCCGCAGCCGTGG + Intronic
1145144235 17:20467390-20467412 GCACAGGGCTGCCTCAGCCAGGG - Intronic
1145175686 17:20698790-20698812 GCACAGGGCTGCCTCAGCCAGGG - Intergenic
1145206397 17:20986267-20986289 GCCTTGGCCTGCCACAGTGCTGG - Intergenic
1145268313 17:21391149-21391171 ACCCAGGCATCCCTCAGCCCTGG - Intronic
1145907424 17:28524124-28524146 GCCAAGGCCTGCGGCTGCCCAGG + Intronic
1147110919 17:38260831-38260853 GCCTAGGCCTCCCTAAGGGCTGG + Intergenic
1147114069 17:38285700-38285722 GCCTTGGCCTCCCAAAGCCCTGG + Intergenic
1147139723 17:38454162-38454184 GACAAGGCCTGCCCCGGCCCCGG - Intronic
1147585996 17:41654367-41654389 GCCCAGCCCTGACTCAGCCTAGG + Intergenic
1147996356 17:44362396-44362418 CTCTAGGCCTGCCTCAGTCCAGG + Intronic
1148013901 17:44507211-44507233 GCCTCAGCCTGCCTCACCCATGG + Intergenic
1148320574 17:46748359-46748381 GCCTCGGCCTCCCACAGCACTGG + Intronic
1148418592 17:47527606-47527628 GCCTAGGCCTCCCTAAGGGCTGG - Intronic
1148502850 17:48104870-48104892 GTCAAGGCCTGCTTGAGCCCAGG - Intronic
1148779306 17:50112591-50112613 TCCCAGACTTGCCTCAGCCCTGG + Intronic
1149096293 17:52844916-52844938 GCCTCGGCCTCCCAAAGCCCTGG + Intergenic
1149731665 17:58952453-58952475 CCCTAGGCCTGCCCATGCCCAGG - Intronic
1150002328 17:61449311-61449333 GCCTAGGCCTCCCAAAGTCCTGG + Intergenic
1150280491 17:63927463-63927485 GCCAAGGCCTCCCCCAACCCAGG + Intergenic
1150292633 17:63990492-63990514 GCACAGCCCTCCCTCAGCCCGGG - Intergenic
1150375167 17:64675277-64675299 GCCTTGGCCTCCCACAGCGCTGG + Intergenic
1150737309 17:67751625-67751647 GCCCAGGCCTTGCTCAGGCCTGG - Intergenic
1151336614 17:73443711-73443733 GCCCAGGTCTTCCTCACCCCTGG - Intronic
1151429275 17:74051580-74051602 CCCTAGGGCTTCCCCAGCCCGGG - Intergenic
1151604487 17:75127842-75127864 GCCTTGGCCTGCCAAAGCACTGG + Intronic
1151749607 17:76029045-76029067 GCCAACGCCAGCCTCACCCCTGG + Intergenic
1151827132 17:76529806-76529828 GCCCTGGCCTGCCTGAGACCTGG - Intronic
1151985995 17:77544166-77544188 GTCTCGGCTGGCCTCAGCCCTGG + Intergenic
1152093574 17:78259648-78259670 GCCTTGGCCTCCCAAAGCCCTGG - Intergenic
1152224078 17:79084700-79084722 GCCCAGGCCTGCCTCTGCCCAGG + Intronic
1152477432 17:80527212-80527234 GCCTGGGCCTGCTACGGCCCTGG - Intergenic
1152539760 17:80969065-80969087 GTGTGGGCCTGGCTCAGCCCTGG - Intergenic
1152553373 17:81040802-81040824 GCCTAGGCCAGCCCCACACCAGG - Intronic
1152656167 17:81520067-81520089 GCCACGGCCTGGCCCAGCCCTGG - Intronic
1152692426 17:81725514-81725536 GCCTTGGCCTCCCATAGCCCTGG + Intergenic
1152728626 17:81959611-81959633 GCCTCCCCCCGCCTCAGCCCTGG + Intronic
1152738902 17:82010683-82010705 GCTTCTGCCTGCCTCAGCCCTGG + Intronic
1152754843 17:82082863-82082885 GCCTGGGCCAGGCACAGCCCCGG - Intronic
1152969788 18:150348-150370 TCCTAGGCCTGGCACAGACCCGG - Intergenic
1153250237 18:3114631-3114653 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1153459976 18:5322586-5322608 ACCTTGGCCTCCCTCAGCACTGG + Intergenic
1153883409 18:9440106-9440128 GCCTCGGCCTCCCAAAGCCCTGG - Intergenic
1153887196 18:9477163-9477185 GCCTAGGCCTCCCAAAGCGCTGG + Intronic
1154322461 18:13366186-13366208 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1154414981 18:14171685-14171707 GTCTAGCCCTGACTCAGCCCTGG - Intergenic
1154415643 18:14174017-14174039 GCCTTGGCCTGTCCCTGCCCTGG - Intergenic
1155220969 18:23685477-23685499 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
1155305355 18:24472903-24472925 GCCTCGGCCTTCCAAAGCCCTGG - Intronic
1156111489 18:33732604-33732626 GCCTAGGCCTCCCAGAGTCCTGG - Intronic
1156395964 18:36700232-36700254 GCCTTGGCCTCCCTGAGCTCAGG + Intronic
1157908993 18:51597578-51597600 GCCTAGGCCTCCCTAAGCCCTGG + Intergenic
1159307865 18:66669194-66669216 GCCTAGGCCTCCCAAAGTCCTGG - Intergenic
1160317113 18:77858631-77858653 CCAAAGCCCTGCCTCAGCCCAGG - Intergenic
1160411381 18:78677652-78677674 TCCTTGGCCTGGCTCAGCCGAGG - Intergenic
1160530967 18:79562419-79562441 GCCTTGGCCTCCCACAGCGCTGG - Intergenic
1160662152 19:306198-306220 GCCGCGGGCTGCCCCAGCCCTGG - Exonic
1160697387 19:491677-491699 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697444 19:491810-491832 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697527 19:492009-492031 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697594 19:492174-492196 GCCTGGGGCTGGCTCCGCCCAGG - Intronic
1160835161 19:1121559-1121581 CCCTTGGCCAGGCTCAGCCCTGG - Intronic
1160836252 19:1126085-1126107 GCCCAAGCCTGCCTGAGCCCGGG + Intronic
1161200552 19:3012464-3012486 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1161375395 19:3937184-3937206 GCCCGGTCCTGCCTCACCCCCGG - Intronic
1161400637 19:4065308-4065330 GCCCGGGCCTGACTCAGCCCCGG - Intronic
1161957070 19:7501988-7502010 GCCTAGGCCTCCCAAAGCACTGG - Intronic
1162240418 19:9348744-9348766 GCCTAGGCCTCACTCAGCTCAGG + Intronic
1162331777 19:10034293-10034315 GCCTTGGCCTCCCAAAGCCCTGG - Intergenic
1162405104 19:10468581-10468603 GCCTGGCCCTGCCTCATCCAAGG - Exonic
1162485789 19:10960106-10960128 GCCTAGGCCTCCCTAAGTGCTGG + Intergenic
1162743863 19:12788609-12788631 GGCATGGCCAGCCTCAGCCCTGG + Intronic
1162766620 19:12923859-12923881 GCCTTGGCCTCCCACAGCACTGG + Intronic
1162828312 19:13268010-13268032 GCCTAGGCCTCCCAGAGCGCTGG + Intronic
1163013717 19:14441056-14441078 GCCTGGCCCAGCCTCTGCCCTGG - Intronic
1163166976 19:15505275-15505297 CCCTCAGCCTGCCACAGCCCAGG - Intergenic
1163692564 19:18745495-18745517 GCCTAGGCCGGCTACATCCCTGG + Intronic
1163905468 19:20148690-20148712 GCCTTGGCCTGCCACAGTGCTGG + Intergenic
1163909738 19:20178175-20178197 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
1164115618 19:22215972-22215994 GGGTAGGCCTGGCTCAGCTCAGG - Intergenic
1164643793 19:29844272-29844294 GCCTTGGCCTCCCACAGCGCTGG + Intergenic
1165000503 19:32758026-32758048 ACCTGGGCCTCACTCAGCCCTGG + Intronic
1165169799 19:33883967-33883989 GCCTGGCCAAGCCTCAGCCCTGG - Intergenic
1165829918 19:38725422-38725444 GTCAGGGCCTGCCACAGCCCTGG + Intronic
1166025587 19:40081281-40081303 GCCTCGGCCTCCCAAAGCCCTGG - Intronic
1166261914 19:41645937-41645959 GCCTTGGCCTGCCACAGTGCTGG - Intronic
1166314003 19:41978524-41978546 CCCAAAGCCTGTCTCAGCCCAGG - Intronic
1166571116 19:43797958-43797980 GGCCAGGCCTCCCTCAGACCAGG + Intronic
1166781599 19:45346197-45346219 CCCTAGGCCTCCCCCTGCCCCGG - Intronic
1166936908 19:46339592-46339614 GCCAAGGGCAGGCTCAGCCCAGG + Exonic
1167268015 19:48493125-48493147 GACTTGGCCTCCCTCAGGCCCGG + Intronic
1167943341 19:52965099-52965121 GCCTAGGCCTGCCAAAGTGCTGG - Intergenic
1167986030 19:53316891-53316913 GCCTTGGCCTCCCACAGTCCTGG - Intergenic
1168225062 19:54988765-54988787 GCCTTGGCCTGCCAAAGTCCTGG + Intronic
1168475524 19:56672107-56672129 GCCTCGGCCTCCCTAAGCGCTGG - Intergenic
925376436 2:3389239-3389261 GCCCAGGCCTCTCTCGGCCCAGG + Intronic
926135830 2:10335338-10335360 ACCTAGGCCTGCCTCTCCACAGG - Intronic
926145360 2:10393863-10393885 GCCTTGGCCTCCCTCAGTACTGG - Intronic
926198329 2:10776749-10776771 GCCCAGGCCTGCCAGACCCCCGG + Intronic
926768665 2:16348581-16348603 GCCTAGGCCTGCCAAAGTGCTGG + Intergenic
926797376 2:16629996-16630018 GTCTAGGACTGCCTGAGCCACGG - Intronic
927202777 2:20588863-20588885 GGCTGAGCCTGCCTCAGCCTGGG - Intronic
927544480 2:23940607-23940629 GCCTCGGCCTCACTCAGCTCAGG - Exonic
927692741 2:25219677-25219699 GCCTTCCCCTGCCTTAGCCCTGG - Intergenic
927931339 2:27047044-27047066 GCCTAGGCCTCCCACAGTGCTGG + Intronic
928569328 2:32587486-32587508 GCCTTGGCCTGCCAAAGCACTGG - Intronic
928570209 2:32599388-32599410 GCATAGGCCTCCCTAAGCACTGG - Intronic
929015266 2:37487359-37487381 GCCTTGGGCTGCCTCAGCGCTGG + Intergenic
929036176 2:37694218-37694240 GCCTAGGCCTCCCAAAGCGCTGG - Intronic
930385861 2:50694040-50694062 GCCTTGGCCTGCCAAAGCACTGG + Intronic
930532577 2:52608683-52608705 GCCTAGGCCTCCCAAAGCACTGG + Intergenic
931364841 2:61610157-61610179 GCCTAGGCCTCCCAAAGTCCTGG - Intergenic
931628370 2:64277128-64277150 GGGGAGGCCTGCCTCAGCACGGG + Intergenic
931820087 2:65943180-65943202 GCCCAGGCCTTGCTCAGGCCTGG + Intergenic
932219292 2:69987494-69987516 GCCTTGGCCTCCCAAAGCCCTGG - Intergenic
932704874 2:74016116-74016138 GCCTTGGCCTGCCAAAGCACTGG - Intronic
933493017 2:83012426-83012448 GCCTTGGCCTGCCACAGTGCTGG - Intergenic
933666673 2:84970719-84970741 GCCTAGGCCCGCCCCAGGCGGGG + Intergenic
933699356 2:85243653-85243675 GCCTGGGGCTGCCTCTGGCCAGG - Intronic
934515835 2:94985855-94985877 GCCTCAGGCTTCCTCAGCCCTGG + Intergenic
934552012 2:95268452-95268474 GCCTAGCCCTACCTCTTCCCGGG + Intergenic
934695836 2:96399661-96399683 GCCTAAGCCTGCCTCCACCCTGG + Intergenic
934728250 2:96638724-96638746 GCCTAGGCCTCCCAAAGCGCTGG - Intronic
934947831 2:98554706-98554728 GGCTGGGCCAGCCTCAGACCTGG + Intronic
935037030 2:99387155-99387177 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
936341783 2:111640125-111640147 GCCTTGGCCTCCCTTGGCCCTGG - Intergenic
936789810 2:116138369-116138391 GCCTCGGCCTACCAAAGCCCTGG - Intergenic
937360641 2:121227430-121227452 GCCTTGGCCTCCCACAGTCCTGG - Intronic
937826299 2:126371796-126371818 GCCTATGCCTCCCTCGGCCTAGG - Intergenic
937826629 2:126373898-126373920 GCCTATGCCTCCCTCGGCCTAGG + Intergenic
937952352 2:127398286-127398308 GCCCAGGACTGCCTCAGCCCCGG + Intergenic
937985222 2:127635312-127635334 GGCAGGGCCAGCCTCAGCCCTGG + Intronic
938839342 2:135144032-135144054 GCCCAGGCCTCACTCAGCCCTGG + Intronic
939021530 2:136963391-136963413 CCCTCGGCCTCCCTAAGCCCTGG - Intronic
939633876 2:144557848-144557870 GCCTTGGCCTCCCAAAGCCCTGG + Intergenic
940848586 2:158667038-158667060 CCCTAGTCCTGCCCCTGCCCAGG - Intronic
941436959 2:165484340-165484362 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
944186767 2:196957679-196957701 GCCTTGGCCTCCCAAAGCCCTGG + Intergenic
944410796 2:199440291-199440313 GCCTGTGGCTGCCTTAGCCCAGG - Intronic
944569760 2:201032209-201032231 GCCTTGGCCTCCCACAGTCCTGG + Intronic
944661169 2:201923208-201923230 GCTTAGGCCAGCCAGAGCCCAGG - Intergenic
945009888 2:205449478-205449500 GCCTAGGCCTCCCAAAGCGCTGG + Intronic
945099672 2:206252516-206252538 GCCTAGGCCTCCCAAAGTCCTGG + Intergenic
945227589 2:207548176-207548198 GCCTAGGCCTCCCAAAGCGCAGG + Intronic
945256356 2:207806656-207806678 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
946185894 2:217980150-217980172 ACCTAGTCCTGGCCCAGCCCAGG + Intronic
946236368 2:218326891-218326913 GCCACGGCCTGCCTCCTCCCGGG - Intronic
946403905 2:219483020-219483042 CCCCAGGCCCACCTCAGCCCTGG - Intronic
946636184 2:221730175-221730197 GCCTCTGCCTGCCTAAGTCCTGG - Intergenic
947529082 2:230897320-230897342 GCCTTGGTCTCCCTCAGTCCTGG + Intergenic
948150250 2:235739204-235739226 GCCTAGCTCTGCCTGAACCCTGG - Intronic
948428605 2:237903986-237904008 GCCTAGGCCTCCCCCAGCGTTGG + Intronic
948699003 2:239748959-239748981 GCCTAGCCCTGTCACAGCCCAGG - Intergenic
949069509 2:242015759-242015781 GCCCAGGCCTGGCTCAGCTGTGG - Intergenic
1169088013 20:2839291-2839313 GCTGAGGTCTGCCTCAGCCTTGG - Intronic
1170225573 20:13988285-13988307 GCCTAGGCCTCCCAAAGCGCTGG + Intronic
1170598258 20:17821580-17821602 GCCTTGGCCTCCCACAGCGCTGG - Intergenic
1170712899 20:18808154-18808176 GCCTTGGCCTCCCAAAGCCCAGG + Intergenic
1171368641 20:24645691-24645713 GCCTCCGCCTCTCTCAGCCCAGG - Intronic
1171423963 20:25038065-25038087 GCCTGGGCCCGCCTTGGCCCAGG - Intronic
1172121864 20:32603321-32603343 GCCCAGGCCTTCCTCCGGCCTGG - Intronic
1172461930 20:35125631-35125653 GCCTCGGCCTGCCAAAGCGCTGG + Intronic
1172853568 20:37984030-37984052 CCCTGGGCCTGCCTCAACCCTGG - Intronic
1174167573 20:48596066-48596088 GCCCAGTCCTGCCTCTTCCCAGG - Intergenic
1174393771 20:50233775-50233797 GGGCAGGCCTGCCTCGGCCCCGG - Intergenic
1174697508 20:52575053-52575075 GCCTAGGCCTCCCAAAGCACTGG + Intergenic
1174897967 20:54470868-54470890 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
1174945281 20:54978424-54978446 ACCTAGTTCTGCCCCAGCCCTGG + Intergenic
1175383782 20:58581257-58581279 GCCTTGGCCTGCCACAGTGCTGG + Intergenic
1175450976 20:59067825-59067847 GCCTGAGCCTGCGGCAGCCCTGG - Intergenic
1176146222 20:63566694-63566716 GCCGAGCCCCACCTCAGCCCTGG + Intronic
1176333156 21:5569174-5569196 GCCTTGGCCTCCCACAGCACTGG - Intergenic
1176394601 21:6251778-6251800 GCCTTGGCCTCCCACAGCACTGG + Intergenic
1176442556 21:6737326-6737348 GCCTTGGCCTCCCACAGCACTGG - Intergenic
1176466818 21:7064396-7064418 GCCTTGGCCTCCCACAGCACTGG - Intronic
1176490379 21:7446174-7446196 GCCTTGGCCTCCCACAGCACTGG - Intergenic
1176510263 21:7692209-7692231 GCCTTGGCCTCCCACAGCACTGG + Intergenic
1176857685 21:13985259-13985281 GCCTTGGCCTGTCCCTGCCCTGG + Intergenic
1176866914 21:14058940-14058962 GCCTTGGCCTGTCCCTGCCCTGG - Intergenic
1178079477 21:29048330-29048352 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
1178364507 21:31977945-31977967 GCCTAGGCCTCCCAAAGCGCTGG + Intronic
1179354751 21:40648984-40649006 GCCTGGGCCTTGCTCAGCCCCGG - Intronic
1179902166 21:44399937-44399959 CCCTAGGCCTGGCACAGCCCAGG - Intronic
1180141453 21:45895931-45895953 GCCGAGGTCTGCATCTGCCCAGG - Intronic
1180549335 22:16528462-16528484 GCCCTGCCCTGACTCAGCCCTGG + Intergenic
1181355358 22:22293374-22293396 GCCCTGCCCTGACTCAGCCCTGG - Intergenic
1181633050 22:24161470-24161492 TCCTAGTTCTCCCTCAGCCCTGG - Intronic
1182039857 22:27229286-27229308 GCCCATCCCTGCCTCATCCCTGG + Intergenic
1182097757 22:27637536-27637558 TCCTGGGCCTCCCTGAGCCCTGG + Intergenic
1182227742 22:28812644-28812666 GCCTAGGCCTCCCTAAGCACTGG + Intergenic
1183479073 22:38052954-38052976 CCCTTTGCCTGCCTCAGCCTGGG + Intergenic
1183630148 22:39027722-39027744 GCCTCCCCCTGCCCCAGCCCTGG + Intronic
1184455640 22:44608209-44608231 GCCCAGGCCTGCCTCACCGAGGG - Intergenic
1184471362 22:44698078-44698100 CCCTAAGCCTGGCTCAGCCCCGG - Intronic
1184658645 22:45955219-45955241 GCCTGGCCCTGCCACACCCCAGG + Intronic
1184665937 22:45989086-45989108 GCCTAACCCAGCCTCAGCCCTGG - Intergenic
1184841906 22:47057050-47057072 GCCTGACCCTGCCTTAGCCCCGG + Intronic
1184858601 22:47160528-47160550 GCCTAGACCTCCCACTGCCCCGG - Intronic
1184859770 22:47166721-47166743 GCCCAGGGCTGCCTCATGCCGGG - Intronic
1184896757 22:47412229-47412251 GCCTCGGCCTCCCAAAGCCCTGG - Intergenic
1184955850 22:47885495-47885517 GCCTTGTCCTCCTTCAGCCCCGG + Intergenic
1185061585 22:48609824-48609846 GCCAAGGGCTGCCTGAGCCACGG - Intronic
1185154648 22:49185945-49185967 TCCTAGTCCAGCCTCTGCCCTGG + Intergenic
1185190366 22:49432649-49432671 GCCTGCCCCTGCCTCAGCACTGG + Intronic
1185275602 22:49949118-49949140 CCCTAGACGGGCCTCAGCCCTGG - Intergenic
1185294537 22:50046730-50046752 TCCTGGGCAGGCCTCAGCCCTGG + Intronic
1185387040 22:50538337-50538359 GCCCAGGCCTCCCTCAGCGACGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949939144 3:9140940-9140962 TCCTATGCCTGCCTAACCCCTGG - Intronic
950464898 3:13147880-13147902 GCCTAGGCCTGCCAAAGTGCTGG + Intergenic
950572708 3:13811866-13811888 GCCCGGGCCTCCCTGAGCCCTGG + Intergenic
950770461 3:15306920-15306942 GCCTAGGCCTCCCAAAGCGCTGG + Intronic
951207136 3:19936616-19936638 GCCTAGGCCTCCCACAGTGCTGG - Intronic
951232623 3:20197517-20197539 TCCTAGGCCTGCATCAACCCAGG - Intergenic
951438674 3:22696219-22696241 GCCTAGGCCTCCCAAAGCACTGG - Intergenic
952366062 3:32675899-32675921 GCCTTGGCCTCCCAAAGCCCTGG - Intergenic
952965740 3:38620193-38620215 CCCCAGGCCTGCTGCAGCCCAGG - Intronic
953178468 3:40574139-40574161 GCCTATTCCTGACTCAGCCTGGG - Intronic
953182683 3:40611216-40611238 GCCTAGGCCTCCCTAAGTGCTGG + Intergenic
953341321 3:42136373-42136395 GCCTAGGCCTCCCAAAGCACTGG - Intronic
953395572 3:42566752-42566774 GCCTTGGCCTTCCAAAGCCCTGG - Intronic
953399048 3:42596601-42596623 CCCTAGGCCTGCCTTGTCCCAGG + Intronic
954081262 3:48213154-48213176 GCCTTGGCCTGCCACAGTGCTGG - Intergenic
954335879 3:49917209-49917231 GCCTTGGCCTCCCACAGTCCTGG + Intronic
954371052 3:50169765-50169787 GGCTGGGTCTGCATCAGCCCTGG + Intronic
954681505 3:52348604-52348626 GCCTGGGCCTGACTCAGCCCAGG - Intronic
955118491 3:56031136-56031158 CACCAGGCCTGCCCCAGCCCAGG + Intronic
955307617 3:57849922-57849944 GCCTAGGCCTCCCAAAGTCCTGG - Intronic
955687924 3:61563509-61563531 GCCAAGTCCTGCCCTAGCCCGGG + Intronic
955840465 3:63107410-63107432 GCCTAGGCCTCCCAAAGCACTGG + Intergenic
956148153 3:66213102-66213124 AACTAGGCCTGGCGCAGCCCAGG + Intronic
956565340 3:70630955-70630977 GCCTAGGCCTTCCAAAGCACTGG - Intergenic
959418923 3:106110452-106110474 GCCTTGGCCTGCCACAGTGCTGG + Intergenic
959737140 3:109672396-109672418 GTCTAGGCCTACCAAAGCCCTGG + Intergenic
960573428 3:119206838-119206860 GCCTGGGCCTGCCTGAGCATTGG - Intergenic
960937584 3:122913056-122913078 GCCTAGCCCCTCCGCAGCCCTGG - Exonic
961305681 3:125958236-125958258 GCCGCCGCCTGCCTCCGCCCAGG + Intergenic
961369691 3:126421945-126421967 GCCTAGGGCTCCCTCAGCCATGG + Intronic
961379082 3:126485716-126485738 CACTAGGCCTGACTCAGACCTGG + Intronic
961829562 3:129616497-129616519 GCCAAGGCCTGCCGGGGCCCAGG + Intergenic
965621301 3:170644702-170644724 CCCATGGCGTGCCTCAGCCCTGG - Intronic
966874699 3:184315247-184315269 AGCTAGGCCTGCCGCCGCCCAGG - Intronic
966912743 3:184568644-184568666 GGCAAGGCCCTCCTCAGCCCTGG - Intronic
967667091 3:192185610-192185632 GCCTAGGCCTCCCACAGTACTGG - Intronic
967764601 3:193264760-193264782 GCCTTGGCCTCCCACAGCGCTGG + Intronic
967826698 3:193882824-193882846 GCCTTTGCCTGCCTCTGCCATGG - Intergenic
967881181 3:194302805-194302827 GCCTCGGCCTCCCTAAGCGCTGG - Intergenic
968086404 3:195875879-195875901 GCCTAAGGCTGCCCCAGCTCTGG + Intronic
968091923 3:195903465-195903487 GCCTCGGCCTGCCAAAGTCCTGG - Intronic
968107198 3:196009458-196009480 GCCCAGGCCTGCCACAGCCATGG + Intergenic
968277706 3:197453426-197453448 GCCTCGGCCTCCCACAGCGCTGG - Intergenic
968377104 4:53094-53116 GGCTTGGCCTGACGCAGCCCAGG - Intergenic
968609601 4:1551058-1551080 GTCTAGGCCTGCTTCACCTCTGG - Intergenic
968620677 4:1602123-1602145 GACTAGGCCTGCCTCATGCATGG + Intergenic
968622320 4:1609348-1609370 GCCCAGGCCTGCACCTGCCCCGG + Intergenic
968763976 4:2458649-2458671 GCCTGGTCCCGCCCCAGCCCAGG - Intronic
969045328 4:4332437-4332459 GCCTTGGCCTCCCTAAGCTCTGG + Intergenic
969369086 4:6719928-6719950 GCCTAGGCCTCCCAAAGCCCTGG - Intergenic
969846638 4:9924887-9924909 GCCCAGGCCTGCCTTAGTTCAGG + Intronic
971389232 4:26170289-26170311 GCCTCGGCCTCCCAAAGCCCTGG - Intronic
972474226 4:39435365-39435387 GCCTCGGCCTCCCAAAGCCCTGG + Intronic
973051725 4:45607219-45607241 GCCTCAGCCTGCCTGCGCCCAGG + Intergenic
973183289 4:47294281-47294303 GCCTCGCCCTGCTTCAGCTCGGG - Intronic
973991040 4:56407565-56407587 GCCTTGGCCTGCCAAAGTCCTGG + Intronic
975392242 4:73833657-73833679 GCCCGGGCCTGCCCCAGCTCTGG - Intergenic
975887451 4:78982403-78982425 GCCTCGCCCTGCTTCAGCTCAGG + Intergenic
977304937 4:95311792-95311814 GCCTAGGCCTCCCAAAGCTCTGG - Intronic
978504873 4:109445659-109445681 TGCTAGGCTTGCTTCAGCCCAGG - Intronic
978814411 4:112886413-112886435 GCCTCGGCCTCCCTAAGTCCTGG - Intronic
980549023 4:134308768-134308790 GCCTAGGCCTGCCAAAGTGCTGG + Intergenic
982080753 4:151787190-151787212 GCCTAGGCCTCCCACAGTGCTGG + Intergenic
982259220 4:153479959-153479981 GCCTTGGCCTCCCACAGTCCTGG - Intronic
982363029 4:154543396-154543418 GCCTAGGCCTCCCAAAGCACTGG + Intronic
982604152 4:157492377-157492399 GCCTAGGCCTCCCTAAGTGCTGG + Intergenic
983905332 4:173175821-173175843 GCCTAGGCCTCCCAAAGCGCTGG - Intronic
984248356 4:177302689-177302711 GCCTTGGCCTGCCAAAGTCCTGG - Intergenic
984533275 4:180944136-180944158 GCCTTGGCCTGCCACAGTGCTGG + Intergenic
984984965 4:185319446-185319468 GCCTTGGCCTGCCACAGTGCTGG + Intronic
985337387 4:188911395-188911417 TCCAAAGCCTGCCTCAGTCCAGG - Intergenic
985627853 5:999321-999343 ACCCAGTCCTGCCTCAGCCATGG + Intergenic
985654295 5:1121938-1121960 CCCTAGGCCTGCTTCATGCCAGG + Intergenic
985764134 5:1768039-1768061 GCCCAGGGCTCCCTCAGCCCAGG - Intergenic
985790980 5:1926641-1926663 CCCTGCGCCTGCCCCAGCCCCGG + Intergenic
985885091 5:2671231-2671253 GTGTGGCCCTGCCTCAGCCCAGG - Intergenic
986039000 5:3968727-3968749 GCCTCGGCCTCCCAAAGCCCTGG + Intergenic
986549269 5:8934691-8934713 GCCCTGGCCTGGCTGAGCCCTGG + Intergenic
986893372 5:12335909-12335931 GCGTAGGCCTTCCACAGCCAGGG + Intergenic
987503199 5:18739589-18739611 GCCTTGGCCTTCCAAAGCCCTGG + Intergenic
987654552 5:20789607-20789629 GCCTAGGCCTTCCAAAGACCTGG - Intergenic
987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG + Intergenic
987856447 5:23425180-23425202 GCCTATGTCTCCCTCAGCCTAGG + Intergenic
988066584 5:26233103-26233125 GCCCAGGCCTGCCACAGCCATGG + Intergenic
988078211 5:26381187-26381209 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
988741089 5:34072235-34072257 GCCTAGGCCTTCCAAAGACCTGG + Intronic
989256858 5:39375633-39375655 GCCTTGGCCTCCCTCAGTGCTGG - Intronic
990581449 5:57170997-57171019 GCCTAGGCCTGCCAAAGTGCTGG + Intergenic
990599408 5:57342377-57342399 GCCTAGGCCTCCCAAAGCACTGG + Intergenic
991370834 5:65917988-65918010 GCCTAGGCCTCCCAAAGTCCTGG - Intergenic
991547148 5:67795351-67795373 ACCTTGGCCTGCTTGAGCCCTGG - Intergenic
992402366 5:76423371-76423393 GCCTAGGCCTGCCAAAGTGCTGG - Intronic
994012751 5:94925656-94925678 GCCTAGGCCTGCCAAAGTGCTGG + Intronic
997328591 5:133042845-133042867 GCCTCGGCCTCCCACAGCGCTGG + Intergenic
997388851 5:133497008-133497030 GCCTCTGCCCACCTCAGCCCAGG + Intronic
997654754 5:135546500-135546522 GCCTAGGGCTGCCTGACCCTGGG + Intergenic
997791650 5:136767495-136767517 GCCTTGGCCTTCCAAAGCCCTGG - Intergenic
997867394 5:137476673-137476695 GCCTCGGCCTGCCAAAGCGCTGG - Intronic
999282116 5:150372717-150372739 GCCTTGTCCTGCCCCAGGCCTGG - Intronic
1000079687 5:157833099-157833121 GCCTTGGCCTGCCCCAGTGCCGG - Intronic
1000378038 5:160602528-160602550 GGCAAGGCCTGCCAAAGCCCTGG + Intronic
1001100990 5:168814144-168814166 GCCTCGGCCTCCCAAAGCCCTGG - Intronic
1001160662 5:169309924-169309946 GCCTAGGCCTCCCAAAGCGCTGG - Intergenic
1001744997 5:174085768-174085790 ACCTAGGCCTTCCTCTGGCCTGG - Intronic
1002066323 5:176653751-176653773 GGCTATGTCTGCCTCTGCCCTGG - Intronic
1002173059 5:177386013-177386035 GCCTATGCCTTCCCCAGCCTGGG + Exonic
1002560710 5:180080173-180080195 GCCTCAGGCTTCCTCAGCCCAGG - Intergenic
1002708594 5:181180184-181180206 GCCCAGGGCTGCCTCTGTCCAGG + Intergenic
1002840368 6:900121-900143 GCCTTGGCCTCCCTGAGTCCTGG + Intergenic
1002942835 6:1733218-1733240 ACCTTGGCCTGCCTCTTCCCAGG - Intronic
1003635597 6:7828870-7828892 GCCCAGGCTGGCCTGAGCCCTGG - Intronic
1005024658 6:21450874-21450896 GCCTTGGCCTCCCAAAGCCCTGG + Intergenic
1005874882 6:30003263-30003285 GCCTAGGCCTGCATCATCTGAGG - Intergenic
1006266123 6:32925737-32925759 GCCTCGGCCTCCCTCAGTGCTGG - Intergenic
1006719626 6:36141925-36141947 GGCTAGTCTTGCCACAGCCCTGG + Intronic
1007063268 6:38963613-38963635 GCCTTGGCCTGCCACAGTGCTGG + Intronic
1007072457 6:39047656-39047678 GGCTGGACCTGCCTGAGCCCAGG - Intergenic
1007426680 6:41750744-41750766 GCCTTGGCCTCCCAAAGCCCTGG - Intronic
1007459737 6:42009360-42009382 GCCTCGGCCTCCCAAAGCCCTGG - Intronic
1007536953 6:42600593-42600615 GTCTAGGCCTGCCTCAAACTGGG + Intronic
1007746346 6:44045830-44045852 TCCCAGGCCTGCCTCTGGCCAGG + Intergenic
1009391452 6:63148594-63148616 GCCTAGGCCTCCCACAGTGCTGG - Intergenic
1013193566 6:107825315-107825337 GCCTAAGCCTTCGTTAGCCCTGG - Intergenic
1013252027 6:108344029-108344051 GCCTAGGCCTCCCAAAGCGCTGG - Intronic
1014083341 6:117313313-117313335 GCCTTGGCCTCCCACAGTCCTGG - Intronic
1014759691 6:125342805-125342827 GCCTAGGCCTCCCACAGTGCTGG - Intergenic
1015240759 6:131021045-131021067 GCCTTGGCCTCCCACAGCACTGG + Intronic
1015744959 6:136499747-136499769 GCCTAGGCCTCCCAAAGTCCTGG - Intronic
1016465593 6:144322011-144322033 GCCTCGGCCTCCCACAGTCCTGG + Intronic
1017552995 6:155530031-155530053 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
1018379698 6:163247295-163247317 CCACAGGCCTGCCACAGCCCTGG + Intronic
1018911078 6:168101233-168101255 TCCTAGACCCGCCTCAGTCCTGG + Intergenic
1019139782 6:169936056-169936078 GCCCAGGCCTGCCTGCCCCCAGG + Intergenic
1019282570 7:207809-207831 GCCTCGGCCTGGGGCAGCCCCGG - Intronic
1019290066 7:245982-246004 TCCCAGGCCTGGCTCAGCCCCGG - Intronic
1019398717 7:838165-838187 GCCTAGGCCTCCCTAAGTGCTGG + Intronic
1019526089 7:1481137-1481159 GCCTGGGCCTGCCCCAACCCTGG - Intronic
1019563413 7:1668695-1668717 GCCCAGGCCTGGCACATCCCAGG + Intergenic
1019584651 7:1791985-1792007 GCAGAGGCTTGCCTGAGCCCAGG + Intergenic
1019601998 7:1889452-1889474 CCCTAGGCCAGGCCCAGCCCAGG + Intronic
1019792622 7:3026757-3026779 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1019839342 7:3424159-3424181 GCCTTGGCCTGCCTAAGTGCTGG + Intronic
1020101653 7:5397351-5397373 GCCCAGGCCGGCCCCTGCCCGGG + Intronic
1020232035 7:6326630-6326652 GCCTAGGCCTCCCAAAGTCCTGG + Intergenic
1021079294 7:16344314-16344336 GCCTTGGCCTCCCCAAGCCCTGG - Intronic
1021840577 7:24718707-24718729 TCCTAGGCCCCCCTCACCCCTGG + Intronic
1022725120 7:32974263-32974285 GCCTTGGCCTTCCAAAGCCCTGG + Intronic
1023296924 7:38724839-38724861 GCCAAGGCCTCCCAAAGCCCTGG + Exonic
1023381428 7:39612183-39612205 GCCTTGGCCTCCCACAGCGCTGG - Intergenic
1023677297 7:42643610-42643632 GCCCTGGCCTCGCTCAGCCCAGG - Intergenic
1023826676 7:44014530-44014552 GCCCAGGCCTGGGACAGCCCTGG - Intergenic
1024971986 7:55079110-55079132 GCCCATGCCTGCCTCATTCCAGG - Intronic
1025048480 7:55713581-55713603 GCCTTGGCCTTCCAAAGCCCTGG - Intergenic
1025175020 7:56795171-56795193 GCCTAGGCCTCCCAAAGTCCTGG + Intergenic
1025696783 7:63781244-63781266 GCCTAGGCCTCCCAAAGTCCTGG - Intergenic
1026210630 7:68300847-68300869 GCCTCGGCCTCCCAAAGCCCTGG + Intergenic
1026486716 7:70828412-70828434 GCCTCGGCCTCCCAAAGCCCTGG + Intergenic
1026805025 7:73424079-73424101 GCAGAGCCCTGCCCCAGCCCCGG - Intergenic
1026807140 7:73435661-73435683 GCCAAGGCCTGCCGCGCCCCCGG + Exonic
1026841402 7:73671479-73671501 GCCAGGGCCTGCCTGAGGCCAGG - Exonic
1026891737 7:73986336-73986358 GCCAAGCCCTGCCTGATCCCTGG - Intergenic
1026930060 7:74218945-74218967 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1027236042 7:76298379-76298401 GCCTAGGCCTCCCAAAGCACTGG - Intergenic
1027622028 7:80500151-80500173 ACCTAGACCTGCCTCACTCCTGG + Intronic
1027650069 7:80855517-80855539 GCCTTGGCCTCCCACAGCACTGG + Intronic
1028496206 7:91463630-91463652 GCCTGTGCCTGGCTCAGCCCCGG - Intergenic
1028575938 7:92350606-92350628 GCCTTGGCCTCCCAAAGCCCTGG - Intronic
1028952774 7:96655528-96655550 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
1029405257 7:100371030-100371052 GCCTCGGCCTCCCTCAGTGCTGG - Intronic
1029515151 7:101019117-101019139 GTCTAGGCCTGCCTCTGCTGAGG + Intergenic
1029737835 7:102474285-102474307 GCCCAGGCCTGGGACAGCCCTGG - Intronic
1029754965 7:102567934-102567956 GCCCAGGCCTGGGACAGCCCTGG - Intronic
1029772915 7:102667014-102667036 GCCCAGGCCTGGGACAGCCCTGG - Intronic
1030056322 7:105586726-105586748 GCACAGGCCAGACTCAGCCCGGG - Intronic
1031998203 7:128246710-128246732 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1032424492 7:131811165-131811187 GCCTCGGCCTCCCAAAGCCCTGG - Intergenic
1032485459 7:132283923-132283945 GCCTTGGCCTCCCACAGCACTGG - Intronic
1034190235 7:149208041-149208063 TTCTAGGCCTGCCTCTGCCTTGG + Intronic
1034395491 7:150821260-150821282 GCCTACTCCTGCCCCAACCCTGG + Intergenic
1034898322 7:154891833-154891855 GCCTCGGCCTGCCAAAGCACTGG + Intronic
1035674300 8:1444198-1444220 GCCTTGGCCTCCCACAGCTCTGG + Intergenic
1035692159 8:1567354-1567376 TCCAAGGCCAGCCTCAGTCCTGG + Intronic
1036017570 8:4802255-4802277 TCCTCTGCCTGCCTCAGCCAAGG + Intronic
1036733525 8:11286199-11286221 GCCTAGGCCTCCCACAGTTCTGG + Intronic
1037782551 8:21880327-21880349 GCCTAGGCCTCCCAAAGCCCTGG - Intergenic
1037820054 8:22131088-22131110 GCCTGGGCCTGCCCCCTCCCGGG + Exonic
1037978870 8:23235613-23235635 GACGAGGCTTGCCTGAGCCCAGG - Intergenic
1038747087 8:30263915-30263937 GCCTAGGCCTCCCTAAGTGCTGG - Intergenic
1038755947 8:30340764-30340786 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
1039061563 8:33575810-33575832 GCCTCGGCCTCCCACAGCACTGG - Intergenic
1039694419 8:39895392-39895414 GCCTAGGCCTCCCAAAGCGCTGG + Intergenic
1041004915 8:53488268-53488290 CCCTACGTCTCCCTCAGCCCAGG + Intergenic
1041217006 8:55610828-55610850 GCCTTGGCCTCCCAAAGCCCTGG + Intergenic
1041647436 8:60267679-60267701 CCCTATCCCTGCCTCAACCCTGG - Intronic
1043038742 8:75231963-75231985 GCCTAGGCCTCCCACAGTACTGG + Intergenic
1043640415 8:82443183-82443205 GCCTCGGCCTCCCTAAGCGCTGG - Intergenic
1044006242 8:86940414-86940436 GCCTCGGCCTCCCTCGGCCTGGG + Intronic
1044754070 8:95443758-95443780 GCCTGGGGCTGCCCAAGCCCAGG - Intergenic
1044982967 8:97734446-97734468 GCCTAGGCCTCCCAAAGCACTGG - Intergenic
1045017363 8:98010899-98010921 GCCTAGGCCTGCCTCAGCCCTGG - Intronic
1045140315 8:99273413-99273435 GCCTAGGCCTGCCAAAGTGCTGG + Intronic
1045468623 8:102491363-102491385 GCCTTGGCCTGCCAAAGCACTGG + Intergenic
1045476783 8:102559725-102559747 GCCCTGGCCTGGCTCTGCCCAGG - Intronic
1046461432 8:114542329-114542351 GCCTCGGCCTGCCAAAGTCCTGG - Intergenic
1047334463 8:123922451-123922473 GCCTAAGCCTGCTTCTGACCAGG - Intronic
1047498425 8:125425183-125425205 GCCTCGGCCTGCCTTATCTCAGG + Intergenic
1047836561 8:128699933-128699955 GCCTAGGCCTCCCAGAGCGCTGG + Intergenic
1049059971 8:140268982-140269004 GCCAATCCCTGCCCCAGCCCCGG - Intronic
1049209342 8:141378385-141378407 GCGCACGCCTGCCTCATCCCTGG + Intergenic
1051390253 9:16556048-16556070 GCCTTGGCCTCCCACAGCGCTGG - Intronic
1052344513 9:27395770-27395792 GGCTGAGCCTGACTCAGCCCTGG - Intronic
1052640891 9:31165043-31165065 GCTTCTTCCTGCCTCAGCCCTGG - Intergenic
1053025141 9:34723303-34723325 ACCTGGCTCTGCCTCAGCCCTGG - Exonic
1053060327 9:35025756-35025778 GCCTAGGCCTCCCTAAGTGCTGG - Intergenic
1053471872 9:38352430-38352452 GCCATGGCCTGCCTAAGCCCTGG + Intergenic
1053899334 9:42777712-42777734 GCCTCGGCCTCCCACAGTCCTGG + Intergenic
1055451344 9:76433700-76433722 GCCCAGGCTTCCCTCAGCCCAGG - Intronic
1055957777 9:81790806-81790828 GCCTAGGCCTCCCAAAGCGCTGG - Intergenic
1056193935 9:84211073-84211095 GCCTCGGCCTCCCAAAGCCCTGG + Intergenic
1057636761 9:96776523-96776545 GCCTTGGCCTCCCACAGTCCTGG - Intronic
1057722499 9:97544286-97544308 ACCTCGGCCTTCCTAAGCCCTGG - Intronic
1057994679 9:99810157-99810179 GCCTAGGCCTGCATCCAGCCTGG - Intergenic
1058295620 9:103303320-103303342 ACCTAGGCCTCGCTTAGCCCTGG + Intergenic
1058432003 9:104928074-104928096 GCCCTGCCCTGCCGCAGCCCGGG + Exonic
1058674503 9:107388990-107389012 GGCAAGGCCTGCCTTATCCCCGG + Intergenic
1059404807 9:114093081-114093103 GCCTAGGGCTCCCTCTGCCCTGG - Intronic
1060256167 9:122033048-122033070 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1060345603 9:122813081-122813103 GCCTAGGCCTCCCACAGTGCTGG - Intronic
1060973272 9:127751101-127751123 GCCTTGGCCAGCCCCAGCCCTGG - Intronic
1061095019 9:128451530-128451552 GCCTCGGCCTCCCAAAGCCCAGG - Intergenic
1061199284 9:129127289-129127311 GCTTAAGCCTGCCTCTCCCCAGG + Intronic
1061278736 9:129584937-129584959 GCCTGGCCCTGCCTCTCCCCCGG + Intergenic
1061368083 9:130182836-130182858 CCCTGTGCCTGGCTCAGCCCAGG + Intronic
1061395802 9:130342755-130342777 ACCCCGGGCTGCCTCAGCCCTGG - Intronic
1061398586 9:130356319-130356341 TTCCAGGCCTGCCACAGCCCAGG - Intronic
1062029552 9:134356059-134356081 GCTTGGGCCTGTCTCAGGCCAGG + Intronic
1062125019 9:134855571-134855593 GCCTGTGTCTGCCTCAGCTCAGG + Intergenic
1062554329 9:137107148-137107170 GCCCAGCGCTGCCTCGGCCCTGG - Intronic
1062563845 9:137154907-137154929 GCCTGTGCCTGCCACTGCCCAGG - Intronic
1062567508 9:137169862-137169884 GCCTTGGCCTGTCTGGGCCCAGG - Exonic
1062688263 9:137827556-137827578 CCCTGGGTCTGCCCCAGCCCTGG + Intronic
1062723771 9:138059431-138059453 TCTTAGTCCTGCCTCTGCCCAGG + Intronic
1203428540 Un_GL000195v1:66048-66070 GCCTTGGCCTCCCACAGCACTGG + Intergenic
1203572133 Un_KI270744v1:141152-141174 GGCTTGGCCTGACGCAGCCCAGG + Intergenic
1186012032 X:5145073-5145095 GCCTAGGCCTCCCAAAGCACTGG - Intergenic
1186571024 X:10715225-10715247 GCCTCGCCCTGCTTCAGCTCAGG - Intronic
1187463334 X:19506771-19506793 GCCTTGGCCTCCCAAAGCCCTGG + Intronic
1189808915 X:44762947-44762969 GCCTCAGCCTCCCTCAGCCTGGG - Intergenic
1190750211 X:53355792-53355814 GCCTAGGCCTCCCAAAGCACTGG + Intergenic
1191252243 X:58265231-58265253 GACTAGGCCTGGGTCATCCCAGG + Intergenic
1191626633 X:63277404-63277426 GCCTAGGCCTTCCTAAGTGCTGG - Intergenic
1191834912 X:65454169-65454191 GCCTCGCCCTGCTTCAGCTCAGG - Intronic
1192252617 X:69425366-69425388 GTCCAGGCCTGCCCCAGTCCTGG - Intergenic
1192325405 X:70127997-70128019 GGCTGGGCCTCACTCAGCCCTGG + Intergenic
1192390081 X:70716741-70716763 GCCTCGCCCTGCTTCAGCTCAGG + Intronic
1193809749 X:86037364-86037386 GCCTAGGCCTCCCAAAGTCCTGG + Intronic
1195813388 X:108858773-108858795 GCCTCGCCCTGCTTCAGCTCAGG - Intergenic
1196531708 X:116795211-116795233 GCCTCGGCCTCCCACAGCGCTGG + Intergenic
1198083806 X:133264392-133264414 GCCTGGGCCTCCCAAAGCCCTGG - Intergenic
1199264816 X:145817925-145817947 GCCTCGGACTGGCGCAGCCCAGG - Intronic
1200043784 X:153388797-153388819 CCCTTGGCCTGCGTCAGCTCTGG + Intergenic
1200064392 X:153497608-153497630 GGCTAGGCGGGCCTCAGGCCAGG - Intronic
1200126104 X:153815813-153815835 GGCTAGGCGGGCCTCAGGCCAGG + Intronic
1201190078 Y:11437734-11437756 GCCCTGCCCTGACTCAGCCCTGG + Intergenic
1202583551 Y:26404193-26404215 GCCCTGCCCTGACTCAGCCCTGG - Intergenic