ID: 1045018258

View in Genome Browser
Species Human (GRCh38)
Location 8:98018347-98018369
Sequence CTGTGGAAAGGGCTGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 323}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045018258_1045018265 -4 Left 1045018258 8:98018347-98018369 CCAGCCATCAGCCCTTTCCACAG 0: 1
1: 0
2: 0
3: 28
4: 323
Right 1045018265 8:98018366-98018388 ACAGTAGCTGTGTGGGTGCCCGG No data
1045018258_1045018268 21 Left 1045018258 8:98018347-98018369 CCAGCCATCAGCCCTTTCCACAG 0: 1
1: 0
2: 0
3: 28
4: 323
Right 1045018268 8:98018391-98018413 ACTCGCACAGTGCTAGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045018258 Original CRISPR CTGTGGAAAGGGCTGATGGC TGG (reversed) Intronic
900571096 1:3358598-3358620 CTTCGGAGAGGGCTGAGGGCAGG - Intronic
901294977 1:8154188-8154210 CTGTGGCCTGGGCTGATGGGTGG + Intergenic
901673792 1:10871107-10871129 CTGGGGAAATGGCTGGGGGCGGG + Intergenic
903219301 1:21860080-21860102 CTGGGGACAGGGCTGAGGGTGGG - Intronic
903453570 1:23471189-23471211 ATGAGCAAAGGTCTGATGGCTGG - Intronic
904013876 1:27405914-27405936 TCGTGGAAAGGGCTGGGGGCAGG - Exonic
904497858 1:30897437-30897459 CTGGGGAAAGATCAGATGGCTGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905127902 1:35728673-35728695 CTGTGTAAGGGACTGAGGGCTGG + Intronic
905769021 1:40625524-40625546 CTGTGGGTAGGGCTGTTTGCTGG - Exonic
905895407 1:41542663-41542685 CAGTGCAAGGGGATGATGGCAGG + Intronic
905920620 1:41716415-41716437 CTGTGGGAAGTGCTGATAGGTGG - Intronic
906100313 1:43256118-43256140 ATGTGGAAAGAGATGAAGGCAGG - Intronic
906543829 1:46607811-46607833 CTGTGGCAAGGGCTGATTTCTGG - Exonic
908399361 1:63755934-63755956 CTGTGGAGAGCGCTGAAGTCTGG - Intergenic
910079985 1:83330130-83330152 CCATGGAAAGGGCATATGGCAGG - Intergenic
913320659 1:117586229-117586251 CTATAGAAAGGTCTGTTGGCTGG + Intergenic
916023147 1:160811938-160811960 CTTTGGAATGGGCTGATGGGTGG - Intronic
916329704 1:163600909-163600931 CTGTGGAATGGCCAGATAGCTGG + Intergenic
916652338 1:166843844-166843866 CTGAGGAAAGGGAGGAGGGCAGG + Intronic
916763305 1:167836181-167836203 CAGTGGAAAGGGGTGCTGTCGGG + Intronic
918532587 1:185539580-185539602 TTGGGGAAGGGCCTGATGGCAGG + Intergenic
919513334 1:198493555-198493577 CTGTGGAATGTGGTGATGCCTGG + Intergenic
920915665 1:210256145-210256167 CTGTGACAAGGGCTCCTGGCAGG + Intergenic
922344347 1:224683988-224684010 CTCTGGAAAGGACAGGTGGCTGG - Intronic
922667136 1:227480277-227480299 CTCTGGAAAGTGATGGTGGCAGG + Intergenic
922932021 1:229397239-229397261 CTGTGCAAAGGCCTCAGGGCAGG + Intergenic
922969583 1:229724767-229724789 CTGTGGAGCAGGCTGCTGGCCGG + Intergenic
923078677 1:230633250-230633272 CTGTGGAGAGGTCTCATGGCAGG + Intergenic
923701887 1:236307538-236307560 TGGTGAAAAGGGCTGATGTCAGG - Intergenic
924333028 1:242959140-242959162 CTATGGAAAAGGTTGATAGCAGG - Intergenic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1063427175 10:5959634-5959656 GTGTGGAAGGGGCTGCTGTCAGG + Intronic
1063834779 10:10000245-10000267 TTGTTGAAAGGACTGATTGCTGG - Intergenic
1064178004 10:13091992-13092014 CAGTGAAAAGGGCTGATGGTGGG + Intronic
1067297366 10:44982488-44982510 CTGGGGGAAGGGCTGATGTGTGG + Intronic
1069288608 10:66748048-66748070 CTGTGGTAAGGACTGACAGCAGG - Intronic
1069605333 10:69735417-69735439 CTGTGGAAGGGGCTGGCTGCTGG - Intergenic
1069748153 10:70729038-70729060 TTGTGGAAAGAGCTCATGGTTGG + Intronic
1070248167 10:74751058-74751080 ATGTGGAGAGGGCTGAGGGTGGG - Intergenic
1070787136 10:79168418-79168440 GTGGGGAAAGAGCAGATGGCTGG - Intronic
1070952027 10:80438903-80438925 TTGGGGAAATGGCTGATTGCAGG + Intergenic
1072192787 10:93089810-93089832 CTGGGGACAGGGCAGATGTCAGG + Intergenic
1072559151 10:96554081-96554103 CTTTGGAGATTGCTGATGGCTGG - Intronic
1072736581 10:97883269-97883291 CTCTGGCCAGGGCTGATGGGTGG + Intronic
1073419500 10:103413029-103413051 ATGTGGAAAGGCTTGATGCCTGG + Intronic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074889980 10:117727644-117727666 CAGTGGAAAGGTCTCATGTCTGG - Intergenic
1076198213 10:128536117-128536139 CTCTGGAAAGACTTGATGGCAGG - Intergenic
1076778987 10:132713709-132713731 CCGTGCACAGGGCTGAGGGCCGG - Intronic
1077626618 11:3777896-3777918 CTCTGGAAAATACTGATGGCAGG + Intronic
1079497662 11:21064072-21064094 CAGTGCAAAGGGCTGAAGGCAGG + Intronic
1081591612 11:44427089-44427111 CTGGGGAAAGGGCTGTGGTCAGG + Intergenic
1081661833 11:44893154-44893176 CAGAGGAAAGGGCTGGTGGCAGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083234486 11:61342879-61342901 CTTTGGAAAGGGCTGAGGGAGGG + Intronic
1083682312 11:64357277-64357299 GTGTGGACAGGGGGGATGGCTGG + Exonic
1083883353 11:65558835-65558857 CTGAGGAAAGGGCTAAAGGGTGG + Intronic
1084349384 11:68584299-68584321 CTGGGAAAAGGGCTGCTTGCAGG - Intronic
1084648083 11:70472422-70472444 CTGAGGAAAGGCCTCATGCCGGG + Intronic
1084906262 11:72350156-72350178 CTGGGTAAAGGGCTGAGGGTAGG + Intronic
1085472142 11:76765163-76765185 CTGCTGAGAGTGCTGATGGCAGG - Intergenic
1085701116 11:78747008-78747030 ATGGGGAAGGGGCTGATGCCAGG + Intronic
1085749312 11:79146749-79146771 CTGTGGATAGGGCTGCTCTCAGG - Intronic
1086656383 11:89361871-89361893 CTGTGGAGAGCGCAGTTGGCAGG + Intronic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1088266454 11:107992425-107992447 CGGAGGATAGGGCTGATGGTAGG - Intergenic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1088788773 11:113205682-113205704 CTGGGGAAAAGGCAGATGCCAGG - Intronic
1089023492 11:115242750-115242772 ATGTGGAAAGGCCTGGTGACGGG + Intronic
1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG + Intronic
1089365004 11:117916084-117916106 GTGTGGAAACGTCTGCTGGCAGG - Intronic
1091882329 12:3990050-3990072 CCCTGGAGAGGGCTGAAGGCAGG - Intergenic
1092659801 12:10725701-10725723 CTGTTGGAAGGGCTGAAGGAGGG + Intergenic
1092859272 12:12705978-12706000 CTGTGGCCAGGGGTGAGGGCTGG - Intergenic
1092968903 12:13672578-13672600 CTGTGGGCAGGGAGGATGGCAGG - Intronic
1094117901 12:26937848-26937870 CTCTGGAAAAGGCTGCTGGCTGG + Exonic
1096271083 12:50167023-50167045 CTGTGGGAAGGGCCGAGGGCCGG - Intronic
1097781248 12:63707551-63707573 CTGTGCCAAGGGCTGCTGACAGG + Intergenic
1099233991 12:80060330-80060352 CAGTGGAGAGAGCTCATGGCAGG + Intergenic
1099898293 12:88676655-88676677 CTCTGCAAAGGGCTGCTTGCTGG - Intergenic
1100666030 12:96754634-96754656 CTGTGGAAAGGGCACAGAGCTGG - Intronic
1102233740 12:111281294-111281316 TTGTGCAAAAGGCTGGTGGCTGG - Intronic
1102407522 12:112686645-112686667 CTGGGGAATTGGCTGGTGGCTGG - Intronic
1103993756 12:124816032-124816054 ATGTGCAAAGGTCTGAAGGCTGG - Intronic
1104178529 12:126355865-126355887 CAGTGTAAAGAGCTGATGTCTGG + Intergenic
1104688990 12:130810503-130810525 CTGGGGAAATGGCTGATGCCAGG + Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1105050268 12:133043626-133043648 CTGTAGAAATGGCTAACGGCAGG - Intronic
1108418762 13:50227801-50227823 CTGTGGAAACTGCTGGTGGGTGG + Intronic
1112599333 13:100839913-100839935 CTGTGGAAATGGCTGCTGCCAGG - Intergenic
1113105574 13:106768602-106768624 CACAGGAAGGGGCTGATGGCAGG - Intergenic
1113198548 13:107838120-107838142 ATGTGGAAAGGGTCCATGGCAGG - Intronic
1113662080 13:112114596-112114618 CTGAGCAAAGGGCCGATGGTAGG - Intergenic
1113773659 13:112929594-112929616 CTGTGGAGGGGCCTGAGGGCAGG - Intronic
1113889672 13:113729385-113729407 TCGTGGACAGAGCTGATGGCTGG + Intronic
1117634887 14:57731438-57731460 CAGTGGAAAGGGCAGGTGTCTGG - Intronic
1121723302 14:96127358-96127380 CTGTGCAAAGGGCAGACGCCTGG - Intergenic
1122830374 14:104392889-104392911 CTGTGGACAGGGCAGAGGCCCGG + Intergenic
1122971770 14:105155111-105155133 CAGAGGAAGGGGCTGCTGGCAGG - Intronic
1123028119 14:105438193-105438215 CTGTGGGCAGGGCTGGTGGCTGG + Intronic
1123470159 15:20544778-20544800 CTGTTGAAAGTGATGATGCCAGG + Intergenic
1123647894 15:22455919-22455941 CTGTTGAAAGTGATGATGCCAGG - Intergenic
1124280972 15:28361070-28361092 CTGTTGAAAGTGATGATGCCAGG + Intergenic
1124301732 15:28550555-28550577 CTGTTGAAAGTGATGATGCCAGG - Intergenic
1127337886 15:58008171-58008193 CTGTCAACAGGCCTGATGGCAGG + Intronic
1128543535 15:68552781-68552803 TTGAGGAAAGGTCTGGTGGCAGG - Intergenic
1128748896 15:70134497-70134519 CTTAGGAAAGGGCTGAGGACAGG - Intergenic
1129409500 15:75341307-75341329 TTGTAGAAAAGGCTGATGCCAGG + Intronic
1132320932 15:100924618-100924640 CTGCTGCAAGGGTTGATGGCTGG + Exonic
1132391230 15:101439538-101439560 CTGTGTCATGGGCTGAGGGCAGG - Intronic
1133035226 16:3030596-3030618 CTGGGGAAAGGCCTGAGAGCTGG + Intronic
1133697498 16:8278813-8278835 CACTGAAGAGGGCTGATGGCAGG - Intergenic
1134024925 16:10946250-10946272 CTGTGGAAAGGATTGGTGGGAGG + Intronic
1135121879 16:19773235-19773257 CTGGGGAAAGGGGAGATGGCAGG + Intronic
1135768438 16:25197878-25197900 CTCTGCACTGGGCTGATGGCTGG + Intergenic
1136368746 16:29822547-29822569 CTGTGGGAAGGTCTGGGGGCAGG + Intronic
1136610721 16:31363348-31363370 CTGTGGGAGGGGCTGATGCTGGG - Exonic
1138491673 16:57380773-57380795 CTGGGGAAAGGCCTCAGGGCTGG - Intronic
1138583212 16:57955043-57955065 CTGTGGAAAAGGCCCATAGCCGG - Intronic
1138979572 16:62250627-62250649 TTTTGAAAAGAGCTGATGGCAGG + Intergenic
1139599271 16:67976818-67976840 CTGGGGACAGGGCTGGTGCCAGG - Intronic
1139666506 16:68460627-68460649 CAGTGGAATGGGCTGATGGAAGG - Intergenic
1139962372 16:70725351-70725373 CTGTGGACAGGGCCCTTGGCTGG - Intronic
1141246066 16:82309007-82309029 CTGAGAGAAGGGCTGATGGTGGG - Intergenic
1141613938 16:85199621-85199643 CTGTGAAAAGTGCTGCGGGCCGG + Intergenic
1142140409 16:88470257-88470279 CTGGGGACAGGGCTGCTGGACGG + Intronic
1142161596 16:88560609-88560631 CAGAGAAAAGGGCTGATGGGCGG + Intergenic
1142613843 17:1123981-1124003 CTGTGGGAAGGGCTGGCGGGGGG - Intronic
1142876035 17:2852843-2852865 CTGGGGAAAGGGCTGTGGCCTGG - Intronic
1143121082 17:4607305-4607327 CTGTGGGGCTGGCTGATGGCTGG + Intronic
1143212176 17:5196470-5196492 CTGCTGAGATGGCTGATGGCTGG - Intergenic
1143235291 17:5394309-5394331 TTGAGAAAAGGGCTGCTGGCGGG + Intronic
1143248515 17:5505104-5505126 CTGTGGAAAGGGGAGATTCCTGG - Intronic
1143303661 17:5929302-5929324 CTCAGGAAAGAGCTGACGGCTGG - Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1146617570 17:34369197-34369219 ATGTGGTGAGGGCTGAGGGCTGG + Intergenic
1147570879 17:41570090-41570112 CAGGGGTAAGGGCTGATGACAGG + Intronic
1148900049 17:50868034-50868056 TTGTGGAATGGGCTGAGGGTGGG + Intergenic
1150229971 17:63544421-63544443 CTGTGGTCAGGGCTGGGGGCTGG + Intronic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151429057 17:74050318-74050340 CCGTGGACAGGGCAGAGGGCAGG - Intergenic
1152206035 17:78974820-78974842 CTGTGGACACAGCAGATGGCAGG + Intronic
1152595873 17:81237340-81237362 TAGTGGAAAGAGCGGATGGCAGG - Intronic
1155069777 18:22304480-22304502 CTGTGGAATGGGTTGAGAGCAGG - Intergenic
1156480821 18:37435306-37435328 CTGGGGAATGGGCTGCAGGCTGG - Intronic
1156600839 18:38604178-38604200 CTGTGTAAAGGGATGAGGGTGGG + Intergenic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1159903081 18:74066319-74066341 CTGGGGAAGGGTCTGATGGGAGG - Intergenic
1160796344 19:947462-947484 CTGTGAAACGGGCTGGCGGCCGG + Intronic
1160929714 19:1564692-1564714 CTGGGGAGAGGGCTGGTGCCAGG + Intronic
1161451617 19:4349404-4349426 CTGTGGAAAGCAGTGGTGGCGGG + Intronic
1162491661 19:10995974-10995996 CTCTGTAAATGGCTGCTGGCGGG + Intronic
1164211160 19:23098499-23098521 CTGTGGACAGGGCTGAGGCAGGG - Intronic
1164711016 19:30357310-30357332 ATGTGCAAAGGCCTCATGGCGGG + Intronic
1166978503 19:46619194-46619216 CTGTAGAAAGGACTTATTGCTGG + Intergenic
1168571517 19:57474990-57475012 CTGGGGAAAGGTGTGATGTCAGG - Intronic
925891711 2:8439807-8439829 CTGGGGAAAGGGCTCCTGGTTGG - Intergenic
926285706 2:11486003-11486025 CTGTGGGATGGGCTGGTGACAGG + Intergenic
926965195 2:18402115-18402137 ATGTGGGAAGGGGTGATGGTGGG - Intergenic
927010508 2:18898967-18898989 ATGTGGAAAGGCCTTAAGGCAGG + Intergenic
927638174 2:24831053-24831075 CTGTGGAAAGGGCTGCGACCTGG - Intronic
929374408 2:41268124-41268146 CTGTGCAAAGGCCTTATGGTGGG - Intergenic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
932533687 2:72567631-72567653 CTGAAGAAACGGCTGATGCCAGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933271768 2:80240425-80240447 CTGTGGAGATGGCTGGAGGCAGG - Intronic
934078491 2:88448259-88448281 TTGTGGAAAGGGCTGCTGAAGGG + Exonic
934574777 2:95392944-95392966 CTGGGGAAAGGGGTGAGGGATGG + Intergenic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
935080409 2:99787516-99787538 CTGTGGCAAGGGCTGGGAGCTGG - Intronic
935657864 2:105440160-105440182 ATGTGGAAGGTGTTGATGGCTGG + Intergenic
937242228 2:120469627-120469649 CTATGGAAAGGGCTTAGGTCAGG - Intergenic
937868627 2:126771960-126771982 CTCTGGAAAGGGCTGAGGGTCGG + Intergenic
938316069 2:130328972-130328994 CTGAGAGAAGGGCTGGTGGCTGG - Intergenic
940004997 2:149002053-149002075 CTGTGGAGGGGGCTGCTGCCGGG + Intronic
940921366 2:159311182-159311204 CTGAGGAAAGGGGTGAGGACGGG - Intergenic
944966683 2:204943386-204943408 CAGAGGAAAGGGCTCATTGCTGG - Intronic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946369198 2:219270336-219270358 GTGAGGAAAGGACTGAGGGCTGG + Intronic
948123453 2:235547787-235547809 CAGTAGAAAGGACTCATGGCCGG - Intronic
948589400 2:239039520-239039542 CTGTGCAAAGGCCTGGAGGCAGG + Intergenic
949055230 2:241924487-241924509 CTGTGGGAAGGGCTGGGGCCAGG + Intergenic
949061237 2:241958908-241958930 CTGTGGAAGTTGCTGATGCCAGG + Intergenic
1170155025 20:13261619-13261641 CTGTGGAAAGGACTGGGGCCAGG - Intronic
1171024657 20:21618525-21618547 CTGGAGAAATGGCTGATGCCAGG - Intergenic
1171964691 20:31520649-31520671 CTTTAGAAAGAGCTCATGGCAGG + Intronic
1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG + Intronic
1173078006 20:39839371-39839393 CTTGGGCAAGGACTGATGGCAGG + Intergenic
1173745526 20:45433985-45434007 CTGAGTAAAGTGCAGATGGCAGG - Intergenic
1173857524 20:46260202-46260224 ATGTGGAAATAGGTGATGGCTGG + Intronic
1174117818 20:48239545-48239567 CTGTGGAAATGGCTAGTGGTTGG - Intergenic
1174424523 20:50422709-50422731 TTGTGCAAAGGGCTGGAGGCAGG + Intergenic
1175120707 20:56714146-56714168 CTGTAGAAAGGGCAGATGAGGGG - Intergenic
1175925517 20:62469440-62469462 GTGTGCTAAGGGGTGATGGCCGG - Intronic
1176063575 20:63182763-63182785 CTGTGGAAATGGCTTGTGGTGGG - Intergenic
1177611187 21:23450632-23450654 CTCTTGAAAGGGCTGTTGCCAGG - Intergenic
1178603213 21:34012926-34012948 CTGTGGAGTGAGCTGATGCCTGG + Intergenic
1179129548 21:38622267-38622289 CAGTGGAGAGGACTGAAGGCCGG + Intronic
1179405461 21:41122097-41122119 CTGTCGAGAGGGCTGAGGCCAGG - Intergenic
1180842750 22:18966905-18966927 CTGTGGTGAGAGCAGATGGCAGG + Intergenic
1180954399 22:19735202-19735224 CTGTGCACAGGTGTGATGGCAGG + Intergenic
1181020510 22:20099421-20099443 CTCTGGAAAAGCCTCATGGCAGG - Intronic
1181417684 22:22772138-22772160 CTGGGGCTAGGGCTGATTGCAGG + Intronic
1181620796 22:24089944-24089966 CTCAGGAAATGGCTGATGGCAGG - Intronic
1181998990 22:26904659-26904681 ATGTGCAAAGGCCTGGTGGCCGG + Intergenic
1182257239 22:29048176-29048198 CTGTGGATGGGGCTGACTGCTGG + Intronic
1182336801 22:29589002-29589024 CTGAGGGAATGGATGATGGCAGG - Intergenic
1183132601 22:35853735-35853757 CGGTGGAATGGGGTGGTGGCTGG + Intronic
1183603073 22:38851202-38851224 CTGTGGCTAGTGCTGGTGGCAGG - Intergenic
1184574610 22:45352816-45352838 TGGTGGAAAGGGCTGATCCCTGG - Intronic
1184914977 22:47563136-47563158 CTGTGGGAAGAGGTGAGGGCGGG + Intergenic
1185038453 22:48491293-48491315 ATGTAGAAAGGGTTAATGGCAGG + Intronic
1185314752 22:50174214-50174236 GGGTGGAAAGGGCTGTTGGGAGG + Intronic
949927982 3:9057252-9057274 CTGTGGGCTGGGCTGCTGGCAGG + Intronic
950674909 3:14548855-14548877 CTGTGCAAAGGGCTCAAGGAGGG - Intergenic
951274678 3:20671030-20671052 CTGTGGAAGTGGCAGATGGTAGG + Intergenic
951733024 3:25831858-25831880 CTGTGGTAAGGGCAGCTGCCTGG - Intergenic
952341288 3:32449680-32449702 CTTTGGAGAGAGCTGATGGCTGG - Intronic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
955947057 3:64205493-64205515 CTGGGGACAGGGTTGGTGGCAGG + Intronic
956171347 3:66436070-66436092 TTTAGGAAAGGGCTGAGGGCTGG + Intronic
960147796 3:114221538-114221560 CAGTGGAAAGGGGTGAGGACAGG - Intergenic
961525218 3:127492513-127492535 CAGTGGAAGGGGCTGAAGACTGG + Intergenic
961550864 3:127669962-127669984 GAGTGGAGAGGGCTGATGACAGG - Intronic
961708006 3:128804299-128804321 CTGTGGGGAGGGGTGATGTCAGG - Intronic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
961804167 3:129476846-129476868 AGGTGGAAAGGGCTGGTGACAGG + Intronic
962429066 3:135302579-135302601 CTGATGAAATGGCTGCTGGCTGG - Intergenic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
967962350 3:194936099-194936121 CAGTGGAAATTGCTGATTGCTGG - Intergenic
968725719 4:2247012-2247034 CTGTGCAGAGGGCTCCTGGCTGG + Intergenic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
969333801 4:6495054-6495076 CTGTGGGATGGGGTGTTGGCAGG - Intronic
969422938 4:7107767-7107789 CTGGGGAAAGGAATGAGGGCTGG - Intergenic
972033488 4:34492529-34492551 CTTTGGAAAGACCTAATGGCAGG + Intergenic
975484192 4:74916169-74916191 CACTGGAAAGGGCTGAAGCCAGG - Intergenic
978558559 4:110007206-110007228 GTGTAGAAAGGGATGATGACTGG - Intronic
978868748 4:113548583-113548605 CTGGGGAAAGGGCAGAGGGTGGG - Intronic
980327550 4:131367761-131367783 CGGGGAAAATGGCTGATGGCTGG + Intergenic
981561831 4:146056436-146056458 CTGTAGAAAGGGATGCAGGCTGG + Intergenic
983923381 4:173370997-173371019 CAGTGGACAGTGCTGAGGGCCGG - Exonic
984198497 4:176688834-176688856 CTGAAGAAATGGCTGATGCCAGG - Intronic
984303860 4:177961804-177961826 CTTTTGAAAGGAGTGATGGCAGG - Intronic
984593831 4:181645283-181645305 CTGGGAAACGGGCTGATAGCTGG - Intergenic
984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG + Intronic
984875128 4:184360861-184360883 GTGGGGAAAGGGCTGATGAGTGG - Intergenic
986402979 5:7396682-7396704 CTCTGGCAAGGGCTGCGGGCGGG + Intronic
986552580 5:8974652-8974674 CTGTGGCAATGGCTGCAGGCAGG + Intergenic
988536684 5:32074734-32074756 CAGTGGGAAAGGATGATGGCTGG + Intronic
989465348 5:41748323-41748345 ATGAGGAGAGGGCTGATGGAAGG + Intronic
990353281 5:54939940-54939962 CTGTTGCAAGGGATGCTGGCTGG + Intergenic
992042185 5:72846656-72846678 CTTTAGGAAGGGTTGATGGCTGG + Intronic
992850348 5:80800990-80801012 CTGTAGAAAGGCCTTAAGGCAGG + Intronic
995924343 5:117352523-117352545 CTGTGGAAAGAGCAGATGCTCGG + Intergenic
997706964 5:135964774-135964796 CTTTGTAAAGGGTTGTTGGCTGG + Intergenic
998476897 5:142429515-142429537 ATGTGGAAAGGGCTGATATGTGG + Intergenic
998992893 5:147838079-147838101 CAGTGAAAAGAGCTGATGGGAGG - Intergenic
999537250 5:152530432-152530454 ATGTGGAAAAGGGTGATGGCAGG + Intergenic
999722017 5:154405416-154405438 CTGTGGGCAGCGCGGATGGCTGG - Intronic
1001556911 5:172642825-172642847 CTGTGGACAGGGCTATTGCCAGG + Intronic
1002418907 5:179135286-179135308 GTGTAGACAGGACTGATGGCAGG - Intronic
1004075840 6:12343668-12343690 CTGTGGAAATGCCAGCTGGCTGG - Intergenic
1004427189 6:15514336-15514358 CTGTGGAAAGGGACGAGGCCCGG - Intronic
1006437326 6:34032839-34032861 CTGGGGAGTGGGCTGCTGGCAGG + Intronic
1006478519 6:34273439-34273461 CTGTGGCAAGAGCTAATGGGAGG - Intergenic
1006662891 6:35663624-35663646 CTGAGGAAAGGGCACATGGGAGG - Intronic
1008289779 6:49700607-49700629 CTGTGGAAGGAGCCGACGGCTGG - Intronic
1008489833 6:52074879-52074901 CTGGGGAAAGGATTGGTGGCGGG - Intronic
1008534588 6:52498224-52498246 CTGTGGAAAGGACCACTGGCTGG + Exonic
1010250800 6:73705049-73705071 CGGAGGAAAGAGCTGCTGGCTGG + Intronic
1014060338 6:117064362-117064384 TGGAGGACAGGGCTGATGGCAGG - Intergenic
1015711722 6:136148751-136148773 ATGTGGAAAGGACAGAGGGCTGG + Intronic
1016439983 6:144073641-144073663 CTGTAGCAAGGGCTTATGGGAGG - Intergenic
1017289743 6:152722125-152722147 CTGTGGGAAGTGCTGATGGTGGG - Exonic
1017313722 6:153003506-153003528 CTTTGGAAAGGGATGAGGGTTGG - Intergenic
1017920037 6:158863655-158863677 CCTTGGAAAGGCCTGATGTCTGG - Intergenic
1019648636 7:2144397-2144419 CTTTGGAGAGGGCTGGTGGCGGG - Intronic
1020137644 7:5595654-5595676 CTGTGCAAAGGTCTTATGGCAGG + Intronic
1020473554 7:8567398-8567420 TTGTGGAAAAGGCTGTGGGCAGG + Intronic
1022939836 7:35223616-35223638 CTGTGCCAAGGGCTGCTGACAGG + Intronic
1023411315 7:39891669-39891691 CTTCCAAAAGGGCTGATGGCAGG + Intergenic
1023981141 7:45070870-45070892 CTGGGGAAAGGGCAGAGGGCTGG - Intronic
1024473123 7:49783665-49783687 CTGTGGAAAAGGATGATGTCAGG + Intronic
1024634555 7:51276462-51276484 CAGTGGATAGGGCTTGTGGCAGG - Intronic
1025255142 7:57379577-57379599 CTGTGCAAAGGGCCTGTGGCAGG + Intergenic
1026902599 7:74045306-74045328 CTGGACAGAGGGCTGATGGCAGG + Intronic
1027297748 7:76795409-76795431 CCATGGAAAGGGCATATGGCAGG - Intergenic
1028536520 7:91893834-91893856 CTGTGGATAAGACTGATGACTGG + Intergenic
1029732066 7:102445080-102445102 CTGTGGAAAGGAGGCATGGCTGG - Intronic
1030012886 7:105189048-105189070 CTGAGGAAAGGGCTGGAGTCTGG - Intronic
1031870294 7:127083596-127083618 CTTAGGAAAGGGATGATGGGGGG - Intronic
1032396244 7:131592076-131592098 CTGTGGCCAGGGCTGAGGGAAGG + Intergenic
1032558625 7:132864304-132864326 ATGGGGAAATGGCTGATGGGTGG + Intronic
1032781234 7:135166705-135166727 CTCTGGGAAGGGCTGAGGCCTGG + Exonic
1033280724 7:140004719-140004741 CTGTGGAAAGGGGAGACAGCTGG - Intronic
1034540514 7:151755153-151755175 CTCTGGGAGGGGCTGAAGGCTGG + Intronic
1034704361 7:153127358-153127380 CTGTGAAATGGGGTGAAGGCAGG + Intergenic
1035597620 8:871171-871193 CTGTGGGAAGGGGTGCAGGCTGG - Intergenic
1036095670 8:5722720-5722742 CTGTTGCTAGAGCTGATGGCGGG + Intergenic
1036577782 8:10044752-10044774 ATAAGGAAAAGGCTGATGGCTGG + Intergenic
1037274501 8:17163204-17163226 CTTTGGAAAGAGCTGCTGCCTGG + Intronic
1039255818 8:35718003-35718025 CTGAGGAATGTGCTCATGGCTGG - Intronic
1039743950 8:40406966-40406988 CTGTCTAAAGGGATGTTGGCAGG - Intergenic
1039789442 8:40863005-40863027 CTGTGCAAAGGACTAATGGTTGG + Intronic
1040325578 8:46339872-46339894 AGGTGGCAAGGGCAGATGGCAGG + Intergenic
1043041542 8:75269257-75269279 CTGTTGAACTGGCTGAAGGCAGG + Intergenic
1044700030 8:94957385-94957407 CAGAGGAAAGGGCTGAAAGCTGG + Intronic
1045018258 8:98018347-98018369 CTGTGGAAAGGGCTGATGGCTGG - Intronic
1045167493 8:99623213-99623235 CTTTGCAAAGGTCTGGTGGCAGG - Intronic
1045431409 8:102118258-102118280 CAGGGGACAGGGCTGCTGGCTGG - Intronic
1047203589 8:122785807-122785829 CTGTGCAAAGAGATGATGCCAGG + Intronic
1048232649 8:132659074-132659096 CTGTTGAAAGGGTTGATTCCAGG + Intronic
1048307557 8:133294889-133294911 CAGTGGAAAGGGTTCCTGGCAGG - Intronic
1048443015 8:134473862-134473884 CTGGGGCCAGGGCTGATGTCTGG + Intergenic
1049204143 8:141355555-141355577 CTATGGCCAGGTCTGATGGCAGG + Intergenic
1049747962 8:144270943-144270965 CTGGGGAACGAGCTGCTGGCGGG + Intronic
1051261352 9:15268385-15268407 CTGGGGGAAAGGCTGGTGGCAGG - Intronic
1052862227 9:33444108-33444130 CTATGGAAAGGGCTGGAAGCAGG + Intronic
1053752761 9:41273409-41273431 CGGGGGATAGGGCTGAGGGCCGG + Intergenic
1054258286 9:62837761-62837783 CGGGGGATAGGGCTGAGGGCCGG + Intergenic
1054803419 9:69375636-69375658 CTGTAGAATGAGATGATGGCAGG - Intronic
1054840483 9:69733201-69733223 GTTTGGAAAGGGATGGTGGCAGG - Intronic
1056939324 9:90941633-90941655 CAGGGGAAAGGTCTGGTGGCAGG - Intergenic
1057025262 9:91730299-91730321 ATGGGAAAAGGGCTGATGGAAGG + Intronic
1057031610 9:91780011-91780033 CTGTTGATAGGGATGATGCCCGG + Intronic
1057314071 9:93958024-93958046 CTGTGGAATGGGGTGAGGGCTGG - Intergenic
1057550114 9:96046270-96046292 CTAATGAATGGGCTGATGGCTGG + Intergenic
1057881385 9:98795563-98795585 CTGTGGGAAGGCATGATGGGAGG - Intronic
1059131840 9:111760132-111760154 CTGTAGATAGGGAAGATGGCTGG - Intronic
1059411866 9:114137625-114137647 GAGTGGAAAGGGCTGAAAGCCGG + Intergenic
1059427666 9:114231226-114231248 CTGGGGGAAGGGAGGATGGCAGG + Intronic
1059699535 9:116761633-116761655 CTGTAGAAATGGGTGATAGCAGG + Intronic
1060231091 9:121826007-121826029 GTGTGGAAAGAGATGATGGAGGG + Intronic
1060891552 9:127192430-127192452 CTTAGGAAAGGGCAGATGGAGGG + Intronic
1061250384 9:129422991-129423013 CTGTGGACAGGGCTGCAGGCGGG - Intergenic
1061541684 9:131280895-131280917 CTGTAGAATGGGATGATGACAGG - Intergenic
1061901000 9:133671909-133671931 CTTTGGGAAGGGGAGATGGCAGG + Intronic
1062395591 9:136351368-136351390 CTGTGGACAGGGCAGGTGTCTGG - Intronic
1202800487 9_KI270719v1_random:170614-170636 CGGGGGATAGGGCTGAGGGCCGG - Intergenic
1185747755 X:2585346-2585368 CTGTGTTTAGGGCTGATGTCTGG + Intergenic
1186708868 X:12171959-12171981 GTGTGTTAAGGGCTGATGGGAGG - Intronic
1187159773 X:16753554-16753576 CTGGGGAAATGGCTGATTCCAGG - Intronic
1187433304 X:19244126-19244148 CTGGGGAATGGGTTGATGGGAGG + Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189670632 X:43404680-43404702 CTGTGCAAAGGGCTGAGGAAGGG + Intergenic
1190137055 X:47807029-47807051 TCGTGGAAAGGGCTGGGGGCAGG + Intergenic
1190747316 X:53332240-53332262 CTGTGGAAACGGCAGAGAGCAGG + Intergenic
1194585784 X:95732511-95732533 CTGCGGAGAGGGCAGATGGGCGG - Intergenic
1197702324 X:129608615-129608637 CTGAGGAAAGCGCACATGGCTGG + Intergenic
1199815534 X:151393788-151393810 CTGTTGAGAGGGCTGACTGCTGG + Intergenic