ID: 1045019805

View in Genome Browser
Species Human (GRCh38)
Location 8:98032150-98032172
Sequence AGGTAGGTAAGGAGGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 330}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045019796_1045019805 9 Left 1045019796 8:98032118-98032140 CCAAACAAAACTAAAAAACCTTA 0: 1
1: 0
2: 1
3: 73
4: 765
Right 1045019805 8:98032150-98032172 AGGTAGGTAAGGAGGTGGTCTGG 0: 1
1: 0
2: 4
3: 29
4: 330
1045019801_1045019805 -9 Left 1045019801 8:98032136-98032158 CCTTAGGTTATGGCAGGTAGGTA 0: 1
1: 0
2: 1
3: 3
4: 55
Right 1045019805 8:98032150-98032172 AGGTAGGTAAGGAGGTGGTCTGG 0: 1
1: 0
2: 4
3: 29
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045019805 Original CRISPR AGGTAGGTAAGGAGGTGGTC TGG Intronic
900091287 1:921871-921893 AGGAAGACAAGGAGGTGGTGGGG + Intergenic
900921978 1:5678654-5678676 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
901027301 1:6285401-6285423 AGGGAGGAAGGGAGGTGGACAGG - Intronic
902090325 1:13897968-13897990 TGGTAGGTGAGAAGTTGGTCTGG + Intergenic
902322169 1:15675711-15675733 AGGTAGGTAGGTAGGTAGGCAGG - Intergenic
902322175 1:15675739-15675761 AGGTAGGTAGGTAGGTAGGCAGG - Intergenic
902322203 1:15675870-15675892 AGGTAGGTAGGTAGGTAGGCAGG - Intergenic
902322215 1:15675926-15675948 AGGTAGGTAGGTAGGTAGGCAGG - Intergenic
902322224 1:15675966-15675988 AGGTAGGTAGGTAGGTAGGCAGG - Intergenic
903393213 1:22979691-22979713 AGGTAGGGAAGTAAGAGGTCAGG + Intergenic
905025846 1:34848743-34848765 ATGAAGCTAAGGAGGTGGGCAGG + Intronic
905250119 1:36642974-36642996 GGGTAGGCAAGGGGGTGGGCTGG + Intergenic
905971362 1:42144842-42144864 AAGTAGGAAAGGCTGTGGTCTGG + Intergenic
906478841 1:46187413-46187435 AGGGAAGTAAGGAGGGGGACTGG - Intergenic
909541685 1:76798790-76798812 AGGGAGATAGGGAGGTGCTCAGG + Intergenic
909618404 1:77639073-77639095 AGGTAGGTAGGTAGGTAGGCAGG + Intronic
910246301 1:85142167-85142189 AGGAAGGTGAGGGGGTGGTATGG + Intergenic
912700492 1:111874906-111874928 AGGTAGGTGAGGAGTTAGTTGGG - Intronic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
914420724 1:147526375-147526397 AGGGAGGCAAGGAGATGGTAAGG + Intergenic
915240780 1:154519984-154520006 TGGAGGGAAAGGAGGTGGTCAGG - Intronic
915766820 1:158371548-158371570 AGGTAGGTGAGCAGGTTCTCAGG - Intergenic
916521740 1:165569606-165569628 AGTGAGGTAAAGAGGTGGTGGGG - Intergenic
919730956 1:200913290-200913312 AGGTGGGGGAGGAGGAGGTCAGG + Intronic
919801973 1:201359566-201359588 AGGTAGGGAAGGAGGGGGCAGGG + Intronic
920966421 1:210705041-210705063 AGGAAGGTAGGGAGGTGGGGCGG + Intronic
921651603 1:217685314-217685336 AAATAGGTAAAGAGGTGGTTTGG + Intronic
921747879 1:218758260-218758282 AGGGAGGGAAGGAGGAGGTGGGG + Intergenic
922211511 1:223490254-223490276 AGGTGGGGCAGGAGGTGGTGAGG - Intergenic
922618788 1:226978356-226978378 GGGTGTGTAAGGAGGTGTTCGGG - Intronic
922618849 1:226978634-226978656 TGGAGGGTAAGGAGGTGGGCGGG - Intronic
922618858 1:226978661-226978683 GGGTGTGTAAGGAGGTGGGCAGG - Intronic
923073493 1:230588325-230588347 AGGTAAGTAAGTAGGTGGGCAGG + Intergenic
923073543 1:230588717-230588739 AGGTAAGTAAGTAGGTGTGCAGG + Intergenic
923073548 1:230588737-230588759 AGGTAAGTAGGTAGGTGGGCAGG + Intergenic
923073555 1:230588777-230588799 AGGTAAGTAGGTAGGTGGGCAGG + Intergenic
923073571 1:230588873-230588895 AGGTAAGTAAGTAGGTGGGCAGG + Intergenic
924218398 1:241848451-241848473 AGGAAGGGAAGGAGAGGGTCTGG + Intronic
924309486 1:242725304-242725326 AGGTAGTAAAGGAGGAGGTGTGG + Intergenic
924705865 1:246501594-246501616 AGGTAGGGAATGAGGTCGTAAGG - Intronic
1062866815 10:862828-862850 AGGTGGGAAAGGAGATGTTCAGG - Intronic
1063860195 10:10298686-10298708 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
1064376403 10:14800485-14800507 AGGTAAGTAAGGAAATGGTGTGG + Intergenic
1065903528 10:30228656-30228678 AGGCAGGGGAGGGGGTGGTCAGG - Intergenic
1065933268 10:30497955-30497977 AGGCAGGGAAGGAAGTGGTTAGG - Intergenic
1067216612 10:44309435-44309457 AGGGAGGGAAGGAGGTGGCGGGG + Intergenic
1067234609 10:44437213-44437235 AGGCATGGCAGGAGGTGGTCAGG - Intergenic
1068513205 10:57992730-57992752 AGGTAGGTTAGAGGCTGGTCTGG - Intergenic
1071499585 10:86193828-86193850 AGGGAGGGAGGGAGGTGGTGAGG - Intronic
1072615889 10:97048753-97048775 AGGTAGGTGAACAGGTGGGCAGG + Intronic
1072736867 10:97885104-97885126 AAGTAGGTAAGGAGGAGCTGGGG + Intronic
1073197311 10:101702937-101702959 GAGTAAGTAAGGAGGTGGGCAGG + Intergenic
1073637044 10:105209799-105209821 AGATAGGTAAGAAGGTGGGGTGG + Intronic
1073655076 10:105405660-105405682 GGGGAGGTAAGGAGCTGGGCAGG - Intergenic
1073782746 10:106857271-106857293 GGGTAGGGAAGGAGATGGGCAGG - Intronic
1073892120 10:108113807-108113829 AGGTGGGAATGGAGGTGGGCAGG + Intergenic
1073929713 10:108561075-108561097 AGGTAGGTAGGCAGGTGGATTGG + Intergenic
1074134964 10:110618164-110618186 AGGTAGGGAGGGGGGTAGTCTGG + Intergenic
1076474517 10:130743075-130743097 AGGTGGGGAAGGAGGCGGGCAGG - Intergenic
1076474537 10:130743135-130743157 AGGTGGGGAAGGAGGCGGGCAGG - Intergenic
1076474545 10:130743155-130743177 AGGTGGGGAAGGAGGCGGGCAGG - Intergenic
1078065418 11:8075852-8075874 AGGTAGGAGAGGAGATGGTTGGG + Intronic
1078088118 11:8246927-8246949 AAGGAGGTAAGGGGGTGCTCTGG - Intronic
1078328084 11:10396715-10396737 AGGTATGCAGGGATGTGGTCAGG + Intronic
1079029682 11:16977277-16977299 AGGGAAGGAGGGAGGTGGTCAGG - Intronic
1079589983 11:22170804-22170826 AGGTAGGTAAGTAGGTGGTTGGG + Intergenic
1079877347 11:25876705-25876727 AGTTAGATAAGGAGGTAGTTGGG - Intergenic
1080019762 11:27548196-27548218 AAATAGGCAAGGAGGTGGGCTGG + Intergenic
1080058887 11:27935900-27935922 AGGTAGGTAAGTAGGTAGATAGG + Intergenic
1080484141 11:32687199-32687221 AGGTATGTGAGGAAGTGGTGAGG + Intronic
1080766981 11:35306053-35306075 AGGTAGGCCAGCTGGTGGTCCGG - Exonic
1081711389 11:45218705-45218727 AGGTGGGTAGGGTGGTGGGCTGG + Intronic
1081877360 11:46418142-46418164 AAGGAGGAAAGGAGGTGGTTAGG + Intronic
1082039001 11:47669450-47669472 ACCTTGGTCAGGAGGTGGTCAGG + Intronic
1082991031 11:59207262-59207284 AGGTGGGGAAGGGGGTGGCCAGG + Exonic
1083188110 11:61029669-61029691 AGGTAGGTAGGTAGGTAGTTTGG + Intergenic
1084859596 11:72009602-72009624 AGATAGGGCAGGAGCTGGTCAGG - Intronic
1085732277 11:79010188-79010210 AGGTAGGTAAGGAGAAGGACAGG - Intronic
1086079691 11:82890358-82890380 ATGAAGGTAAGAAGGTGGTATGG - Intronic
1086143079 11:83520569-83520591 AGGTAGGTAAGTAGGTAGGCAGG + Intronic
1086323984 11:85680036-85680058 ATATAGGGAATGAGGTGGTCAGG - Intronic
1086582481 11:88415057-88415079 AGGAAGGAAAGGATGTGGTCTGG + Intergenic
1088429179 11:109739365-109739387 AGGTAGGTAGGGAGGAGGCTGGG + Intergenic
1088442932 11:109891855-109891877 AGGTAGAAATGGAGGTGGACAGG - Intergenic
1088548157 11:110982399-110982421 AGGTAGGCCAGGAGGGGGCCTGG + Intergenic
1090989655 11:131804560-131804582 GGGTAAGCAAGGAGGTGGTGAGG - Intronic
1091619610 12:2076487-2076509 AGGTAGGTAGGGAGGGAGTGAGG - Intronic
1091697649 12:2638786-2638808 AGGTAGGCAAGGAGGCGGGCTGG + Intronic
1092766422 12:11856969-11856991 GGGTAGGTAAGTAGGTGGATAGG + Intronic
1093941253 12:25057222-25057244 AGGTAGGTAGGTAGGTAGACAGG + Intronic
1094332262 12:29307404-29307426 AGGTAGGTAGGTAGGTAGGCAGG - Intronic
1095907611 12:47394089-47394111 AGGTAGGTAGGGAGGTGGTGGGG - Intergenic
1096153820 12:49330938-49330960 AGGCAGGTAAGGAGTTGGCTGGG + Exonic
1096256049 12:50063079-50063101 AGGAAGAAAAGGAGGTGGCCGGG - Intronic
1097657482 12:62385771-62385793 AGAGAGGTAAGGATGTGGTTTGG - Intronic
1098451707 12:70626398-70626420 AGGTAGGTAGGTAGGTAGGCAGG - Intronic
1099062420 12:77928483-77928505 AGGAAGGGAGGGAGGGGGTCGGG - Intronic
1099068055 12:78008447-78008469 TGGTTGGTAAGGAGATGGCCTGG + Intronic
1099830131 12:87831944-87831966 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
1099874099 12:88383046-88383068 AGACAGGAAAGGAGGTGGTCAGG + Intergenic
1100947877 12:99807483-99807505 AGGTATGTCAGGAGGTGGAAGGG + Intronic
1104334509 12:127880845-127880867 AGGTAGGTAGGTAGGTGGATGGG - Intergenic
1104393813 12:128414774-128414796 AGGTAGGTAAGGTGGCAGTGAGG - Exonic
1104519665 12:129461711-129461733 AGGTAGGTAGAGAGGTGGGTGGG + Intronic
1105474840 13:20720855-20720877 GGGTTGGGAGGGAGGTGGTCTGG - Intronic
1106099550 13:26682645-26682667 AGGTGGCGGAGGAGGTGGTCCGG - Exonic
1106468487 13:30033927-30033949 AGGTAGGGGAGGAGGTGGCTGGG - Intergenic
1107001758 13:35554617-35554639 AGGTAGGTAGGTAGGTAGTCAGG - Intronic
1110240786 13:73264445-73264467 AGGTTAGTAAGTAGGTGGGCAGG - Intergenic
1112050027 13:95635927-95635949 AGGGAGGTAAGGAGGTAGGGAGG + Intronic
1112550144 13:100411822-100411844 TGGGAGGTAATGAGGTGGTGGGG - Intronic
1112786923 13:102961389-102961411 AGGTAGGTAGGTAGGTGGGTAGG - Intergenic
1113719717 13:112545845-112545867 AGGAAGGAAAGGAGGTGAGCTGG - Exonic
1113914137 13:113860964-113860986 AGGCAGGTGAGCAGGTGGCCAGG + Intronic
1114514434 14:23288724-23288746 AGGTATGTAAGGAGGGGGAGTGG - Intronic
1116338126 14:43685843-43685865 AGGTAGGTAGGTAGGTAGTTAGG + Intergenic
1116628457 14:47297522-47297544 AGGGAGGTTAGGAGGGGGGCAGG + Intronic
1116698021 14:48201477-48201499 AGGAAGGTAAAGAGGTGCTCTGG - Intergenic
1117075047 14:52093812-52093834 TGGTAGGAAAGGAGGTGGGGTGG - Intergenic
1117956665 14:61128533-61128555 AGGTAGGAAAGGGGGTGGTAAGG - Intergenic
1119591249 14:75889874-75889896 AGGGAGGGAGGGAGGAGGTCAGG + Intronic
1119938879 14:78619373-78619395 AGGTAGGTAGGGAGGTAATTAGG + Intronic
1121526336 14:94621877-94621899 AGCTAGGTGAAGAGGTGGGCAGG - Intronic
1121777173 14:96598432-96598454 AGGTAGAGAAGGAGGTGGGGAGG - Intergenic
1122648821 14:103213764-103213786 AGATTGGTATTGAGGTGGTCTGG - Intergenic
1122970358 14:105149888-105149910 AGGTGGGGAAGGGGGTGGTAGGG + Intronic
1122970384 14:105149940-105149962 AGGTGGGGAAGGGGGTGGTAGGG + Intronic
1122970440 14:105150058-105150080 AGGTGGGGAAGGGGGTGGTAGGG + Intronic
1123018381 14:105386255-105386277 AAGTAGTTAAGGAGCTGGCCTGG + Intronic
1125364933 15:38903558-38903580 AGGTTGGAAGGGAGGTGGTGGGG - Intergenic
1126317706 15:47388062-47388084 AGGTAGGAAAGGAGTGGGGCTGG + Intronic
1127658585 15:61078798-61078820 AGGTAGGTAGGTAGGTGGGTGGG - Intronic
1127997215 15:64160212-64160234 GAGAAGGTAAGGAGGTGGTATGG + Intronic
1129205233 15:74033409-74033431 AGGCAGGTAGGGAGGTGGGTAGG + Exonic
1131873820 15:96784254-96784276 AGGAAGGTAAGTAGGTGGCAGGG + Exonic
1132107496 15:99073886-99073908 AAGTAGGTGAGGAGGTGGGGTGG - Intergenic
1133205695 16:4232171-4232193 AGGCAGGAAAGGAGGTGGGCTGG + Intronic
1133904476 16:10009365-10009387 AGGTAGGTAAGGATGAAGTGAGG + Intronic
1134005303 16:10814998-10815020 AGGTAGGGTAGGAGTTGGTTAGG - Intronic
1134621915 16:15695869-15695891 AGTTTGGTAAGGACTTGGTCTGG - Intronic
1136248007 16:28986147-28986169 AGGTGGGTAGGCAGGTGGCCAGG - Exonic
1138502289 16:57454670-57454692 AGGTGGGTAACAGGGTGGTCAGG + Intronic
1139651763 16:68365770-68365792 AAGGAGGTAAGCAGGAGGTCGGG - Intronic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1140087709 16:71811274-71811296 AGGTAGGTAGGTAGGTGGGTGGG - Intergenic
1140514229 16:75530595-75530617 AGGTATGTAAGTAGGTGGGTGGG - Exonic
1140704650 16:77615426-77615448 AGGTCCTTAAGGAGGTGCTCTGG - Intergenic
1141120284 16:81349196-81349218 GGGTAGGTGAGGACGGGGTCGGG - Intronic
1141172405 16:81699796-81699818 GTGGAGGTAAGGAGCTGGTCGGG + Exonic
1141263557 16:82475520-82475542 TGGGAGGTAAGGGGGTGGTGGGG - Intergenic
1142219778 16:88848402-88848424 AGGTGGATCACGAGGTGGTCAGG + Intronic
1143112525 17:4560361-4560383 AGGTAAGTAAGGGAGGGGTCTGG - Exonic
1143189590 17:5031844-5031866 AGGAAGGTCCGGAGGTGGGCGGG + Intergenic
1143785032 17:9249552-9249574 AGGTGGGGCAGGAGGTGGTCGGG - Intergenic
1143819806 17:9551270-9551292 AGGAAGGTAAGGACTTGGCCTGG - Intronic
1145102416 17:20088088-20088110 AGCTAGGCGAGGAGGTGGGCAGG + Intronic
1146704088 17:34987640-34987662 AGAGAGGTAAGGACGTGCTCAGG - Intronic
1147973778 17:44236020-44236042 AGGTAGGTAGGGGAGTGGTTTGG - Intergenic
1148786137 17:50147186-50147208 AGGAGGGGTAGGAGGTGGTCTGG - Intronic
1148842088 17:50505554-50505576 AGGTAGGGGAGTATGTGGTCAGG - Intergenic
1149498418 17:57133745-57133767 TGGGAGGTATGGAGGTGGCCTGG + Intergenic
1151281516 17:73078405-73078427 AGGTAAGTAAGGAGGTAGGTAGG + Intronic
1151327478 17:73388108-73388130 AGGGAGGAAAGGAGGTGATCTGG + Intronic
1152092912 17:78256903-78256925 GGGAAGGAAAGGAGGTGGTCTGG + Intergenic
1153946363 18:10021578-10021600 AGGTAGGTAAGTGGGTGGGTAGG - Intergenic
1155197036 18:23485207-23485229 AGATAGGAATGGAGGTGGGCAGG - Intronic
1156371773 18:36477538-36477560 AGGTAGGTAGGTAGGTGGGTGGG - Intronic
1157337748 18:46754103-46754125 AGATAGGTAAGCAGGTGCTAGGG + Intronic
1157681212 18:49608522-49608544 AGGGAGATAAGGAGGGGGCCTGG + Intergenic
1157867302 18:51197528-51197550 AGGTAGGTAACTAGGTGGGTGGG + Intronic
1159023630 18:63163242-63163264 AGGAAGGTAAGGAGATTTTCAGG - Intronic
1159028203 18:63206091-63206113 AGGCATTTAAGGAGGAGGTCTGG + Intronic
1161261021 19:3337723-3337745 AGGTGGTAAAGGAGGGGGTCAGG - Intergenic
1161914611 19:7219248-7219270 AGGTTGGAAAGGTTGTGGTCAGG - Intronic
1162126606 19:8502707-8502729 AGGAAGGGAAGGAGGTGGGGAGG + Exonic
1162404891 19:10467676-10467698 AGGCAGAGGAGGAGGTGGTCGGG - Exonic
1162834520 19:13307678-13307700 AGGTAGAGAAGGAGGAGTTCAGG + Intronic
1163315075 19:16535951-16535973 AGGTGGGTGAGGAGGTGGGCAGG - Intronic
1163526426 19:17824423-17824445 CGGTCGGTGGGGAGGTGGTCCGG + Intergenic
1164311354 19:24049077-24049099 AGGTAGGTAGGTAGGTAGTTAGG - Intronic
1164622817 19:29707376-29707398 AGGTGGTAAAGGAGGTGGGCAGG + Intronic
1165735272 19:38171899-38171921 AGGTAGGTAGGTAGGTAGGCAGG + Intronic
1166668655 19:44696996-44697018 GGGAAGGGATGGAGGTGGTCGGG - Intergenic
1167381938 19:49143196-49143218 AGTCAGGGAAGGAGGTGGCCTGG - Intronic
1167510541 19:49893384-49893406 AGGTGGGCGAGGAGGAGGTCAGG + Intronic
925102233 2:1257228-1257250 ACACAGGTAAGAAGGTGGTCGGG - Intronic
925175856 2:1783085-1783107 AGTTAGCTACGGAGGGGGTCAGG + Intergenic
925470464 2:4155797-4155819 AGGTAGGTAAGCAGGTAGATAGG - Intergenic
926585540 2:14681554-14681576 AGGTAGAAATGGAGGTGGTGAGG - Intergenic
927090182 2:19704752-19704774 AGGTAGGTTTGGAGGTGGGGCGG - Intergenic
927707904 2:25308162-25308184 AGGTAGGTAGGTAGGTAGGCAGG + Intronic
930754899 2:54964157-54964179 AGGTACCTAAGTGGGTGGTCTGG + Exonic
931209394 2:60178262-60178284 AGGAAGGAAAGGAGGTGGGGGGG + Intergenic
934775544 2:96934870-96934892 AGCCAGGTAGGGAGGTTGTCAGG - Intronic
935631630 2:105216950-105216972 AGGTAGGAAGCCAGGTGGTCAGG - Intergenic
936474317 2:112826479-112826501 TGGCAGGAAAGCAGGTGGTCTGG - Intergenic
936974362 2:118204531-118204553 GGGTCAGTGAGGAGGTGGTCAGG + Intergenic
937262577 2:120595893-120595915 TTGTAGGCAGGGAGGTGGTCAGG + Intergenic
937861077 2:126710316-126710338 AGGTAGGTAGGTAGGTGGATAGG + Intergenic
938947701 2:136228017-136228039 AGGTAGGTAAGTAGGTAGGTAGG - Intergenic
941286010 2:163612909-163612931 AAGTAGATAATGAGATGGTCTGG + Intronic
942018212 2:171839396-171839418 AGGTAGGTAGGTAGGTGGATAGG + Intronic
942050264 2:172133596-172133618 AGGTTGAGAAGGAGGTGATCAGG - Intergenic
942294143 2:174501100-174501122 AGGCAGGAATGGAGGTGGGCAGG + Intergenic
942331534 2:174829835-174829857 AGGTAGGCAGGCAGCTGGTCAGG + Intronic
944187378 2:196964135-196964157 AGGTAGGTGAGCAGCTGGGCTGG - Intergenic
944399559 2:199309561-199309583 AGGAAGGTAGGCAGTTGGTCAGG + Intronic
947264468 2:228261798-228261820 AGGAAGGTAAACAGGTGGTCAGG + Intergenic
948025287 2:234771566-234771588 AGGAAGGTAGGGAGGTGGATGGG + Intergenic
1170581232 20:17701015-17701037 AGGTAGAAAGGGAGGTGGTGGGG + Intronic
1171031478 20:21680953-21680975 AGGTTGTTAATGAGCTGGTCAGG + Intergenic
1171278809 20:23879878-23879900 AGGGAGGGAGGGAGGTGGTTGGG - Intergenic
1172088810 20:32411971-32411993 AGGTAAGTAAAGAAGTGTTCAGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173089014 20:39952465-39952487 AGGGAGGGAAGGAGGGGGTGAGG + Intergenic
1173162760 20:40664425-40664447 AGGCAGGTAAGGAGGTGGGGCGG + Intergenic
1174359319 20:50017996-50018018 AGGAAGGAAAGGAGGAGGTAGGG - Intergenic
1174411864 20:50341540-50341562 AGCTGGGCAAGGAGCTGGTCTGG + Intergenic
1175558239 20:59890572-59890594 AGGTAGGTAAGTAGGTAGGTAGG + Intronic
1177431236 21:20995060-20995082 AGATAGGTAGGGACGTGGGCAGG - Intergenic
1178091021 21:29163220-29163242 AAGTAATTAAGGAGGGGGTCCGG - Intronic
1178631301 21:34263681-34263703 AGTTAGGTTAGGAGGGGATCAGG - Intergenic
1178643929 21:34369122-34369144 GGGTAACTGAGGAGGTGGTCAGG + Intronic
1179230984 21:39503727-39503749 TGGAAGTTGAGGAGGTGGTCAGG - Intronic
1179899575 21:44382385-44382407 AGGCAGGTAGGCAGGTGGTGAGG + Intronic
1180964419 22:19778936-19778958 AAGTAGGTAAGGGGGAGATCTGG + Intronic
1181661736 22:24355458-24355480 AGGTAGGTAGGTAGGTGGGTGGG - Intronic
1181863316 22:25836005-25836027 TGGTAGGAAGGCAGGTGGTCAGG + Intronic
1182835425 22:33337807-33337829 AGGGAGATAAGGAAGTGGTCAGG + Intronic
1183281666 22:36935750-36935772 AGGAAGGGAAGGAGGAGGTGGGG - Intronic
1184340124 22:43881435-43881457 ACGCAGGTAAGCAGGTGGGCAGG + Intronic
1184831427 22:46991195-46991217 AGGTAGGAAAGCAGGGGGTTTGG + Intronic
951507822 3:23468182-23468204 TGGCAGGAAAGGAGGTGGGCAGG - Intronic
951800130 3:26586656-26586678 AGGTAGGTGAGGAGGAGGGAAGG - Intergenic
952038616 3:29234535-29234557 AGGTAGTGAAGAAGGTGGTTCGG + Intergenic
952534267 3:34293851-34293873 GGGTATGTCAGGAGATGGTCTGG + Intergenic
953728957 3:45428625-45428647 ATGTAGGTAAGGAGTTCATCTGG - Intronic
954898945 3:54002590-54002612 AGGAAGGGAAGGAGGTGGGGAGG - Intergenic
954918682 3:54170609-54170631 AGGGAGGGAGGGAGGTAGTCAGG - Intronic
955776609 3:62440520-62440542 AGGTAGGTAAGGCTGTGGAATGG - Intronic
958693381 3:97497200-97497222 AGGCAGCTAAGTAGGTGGCCAGG - Intronic
960536641 3:118822736-118822758 AGGGAGGGAAGGAGGTGGTCAGG + Intergenic
960987110 3:123287850-123287872 AGGTAGATAAGGAGCCGGGCAGG - Intronic
963767866 3:149356468-149356490 AGGCAGGAATGGAGCTGGTCAGG + Intergenic
964525226 3:157610077-157610099 AGTTAGGTAAGGAGGGGCTGTGG + Intronic
965836491 3:172859216-172859238 AGTTAGATGAGAAGGTGGTCTGG - Intergenic
966431216 3:179832892-179832914 AAGTAGGTAGGTAGGTGGGCGGG - Intronic
968088820 3:195886944-195886966 AGGTGGGTGAGGAGGTGGGAGGG - Intronic
969147954 4:5140746-5140768 AGGGAGGGAGGGAGGTTGTCTGG - Intronic
969535433 4:7753869-7753891 AGGCAGGGAAGGAGGTGATATGG + Intergenic
970191307 4:13522315-13522337 AGGAAGGTAGGGAAGTTGTCAGG - Intergenic
971218110 4:24680675-24680697 AGGGAGGGAAGGAGGTGTTAAGG + Intergenic
972571337 4:40312912-40312934 AAGTAGATAAGGAGGAGGTGGGG + Intergenic
973312643 4:48726133-48726155 GGGTAGGTGGTGAGGTGGTCAGG + Intronic
975405845 4:73988252-73988274 AGGTAGGAAAGGAGGAAGTGAGG + Intergenic
975711390 4:77163304-77163326 AGGTTTTTAAGGAGGTGGTCAGG + Intronic
976268438 4:83206801-83206823 AGGTGGACAAGGAGGAGGTCAGG - Intergenic
978521339 4:109619027-109619049 AGGTAGGTAGGTAGGTAGGCAGG - Intronic
979639432 4:122996527-122996549 AGGTAGGTAAAGAGGTAGCTAGG + Intronic
980246647 4:130254137-130254159 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
981788186 4:148504623-148504645 AGGGAGGTAAGCCAGTGGTCTGG + Intergenic
982074438 4:151724536-151724558 AGGAAGCTAGAGAGGTGGTCGGG - Intronic
982275777 4:153635936-153635958 AGGAAGGTCAGTGGGTGGTCAGG + Intronic
983185573 4:164696633-164696655 AGGTGGGAAAGGAGGTGTACAGG - Intergenic
983404193 4:167304663-167304685 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
984682965 4:182631944-182631966 AGGGAGGGAGGGAGGTGGACAGG + Intronic
988418357 5:30974773-30974795 AGGTGGGCATGGAGGGGGTCTGG - Intergenic
992521277 5:77554284-77554306 AGGTAGGGAAGTAGTTGTTCTGG + Intronic
992745375 5:79815454-79815476 AGATAGGTATGGAGGGGGACAGG + Intergenic
997864300 5:137447625-137447647 TGGTAGGTATGGTGGTGGTGTGG - Intronic
999089866 5:148926754-148926776 AGGCTGGGAAGGTGGTGGTCGGG - Intronic
1001627104 5:173144939-173144961 AGGTAGGTTGTGAGGTAGTCAGG - Intronic
1001682782 5:173570916-173570938 AGGAAGGAAAGGAGGTGTGCAGG - Intergenic
1002523685 5:179804645-179804667 AGGGAAGGAAGGAGGTGGGCAGG - Intronic
1004648256 6:17583664-17583686 AGGGAGGTCAGGAGGAGGTATGG + Intergenic
1005531291 6:26709189-26709211 AGGTAAGTAAAGAGGAGGTCTGG + Intergenic
1005539505 6:26792447-26792469 AGGTAAGTAAAGAGGAGGTCTGG - Intergenic
1006055630 6:31382399-31382421 AGGCAGAGAAGGAGGTGCTCAGG - Intergenic
1006336769 6:33425157-33425179 AGGTAGGGATGGAGGTGGACAGG + Intronic
1006839975 6:37022433-37022455 AGGTAGGAAAGGTGGAGGCCTGG - Intronic
1006921157 6:37628012-37628034 AGGAAGGTGAGGAGTTGGGCAGG + Intergenic
1007179028 6:39915302-39915324 AGGAAGGAAAGAAGGTGGTGGGG + Intronic
1007971020 6:46052537-46052559 AGGTAGGTACAGAGGAGGTGGGG + Intronic
1009010331 6:57834619-57834641 AGGTAAGTAAAGAGGAGGTCTGG - Intergenic
1009275854 6:61678473-61678495 GGATAGGTAAGGAGTTGGTCAGG + Intergenic
1009620679 6:66072033-66072055 AGGGAGGAAAGAAGGTGGTGGGG + Intergenic
1010974799 6:82299575-82299597 AGATAGGTAAGTAGGTAGTTAGG + Intergenic
1012639163 6:101587432-101587454 AGGTAGGTAAGTAGGTAGGAAGG - Intronic
1015803326 6:137082816-137082838 CTGTAGGTAAGCAGATGGTCAGG - Intergenic
1017882534 6:158571950-158571972 AGCTGGGGAAGGAGGTGGCCTGG - Intronic
1018649741 6:165983414-165983436 TGGTAGGGAAGGAGGTGAACAGG + Intronic
1022109236 7:27218185-27218207 AGGTAGGTAAGGAGGGAGGGAGG - Intergenic
1022325423 7:29326554-29326576 AGGTAAGTATGGAGCTGCTCTGG - Intronic
1022524773 7:31029781-31029803 AGATAGGCAAGGATGTTGTCGGG + Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024182190 7:46907828-46907850 AGGTGGGTAAGGAGGAGCTGTGG - Intergenic
1028067053 7:86399345-86399367 AGGGAGATAAGGAGCTGTTCTGG + Intergenic
1028789292 7:94835168-94835190 AGGTGGGTAGGGAGGTGGCCTGG - Intergenic
1029160416 7:98547887-98547909 AGGTAGGTAGGTAGGTTGACAGG - Intergenic
1029160426 7:98547943-98547965 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160430 7:98547963-98547985 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160445 7:98548055-98548077 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160547 7:98548671-98548693 AGGTAGGTAGGGAGACGGGCAGG - Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1030184882 7:106751731-106751753 AGGAAGGGAGGGAGGGGGTCAGG - Intergenic
1033761281 7:144439106-144439128 AGGGAGATAAGGAGATGGTTGGG + Intergenic
1034896858 7:154881780-154881802 CGGCAGGTAAGGAGGAGGTGTGG - Intronic
1035102829 7:156415610-156415632 AGGTGGGTCAGGAGGTGGTTAGG - Intergenic
1035103473 7:156420704-156420726 AGGTGGGGCAGGAGGTGGTATGG + Intergenic
1035530903 8:350201-350223 AGGTAAGTAAGTAGGTAGGCAGG + Intergenic
1035530970 8:350594-350616 AGGTAGGTAGGTAGATAGTCAGG + Intergenic
1035531010 8:350840-350862 AGGTAGGTAAGTAGGTAGGAGGG + Intergenic
1035531137 8:351658-351680 AGGTAGGCAGGTAGGTAGTCAGG + Intergenic
1036655950 8:10677620-10677642 AGGTTAGTTAGGAGGTGGTGGGG - Intronic
1037996040 8:23352981-23353003 AGGTAAGGAAGGAGGTGGGGTGG + Intronic
1038240553 8:25804221-25804243 AGGTAGGTAGGTAGGTGGGTAGG - Intergenic
1039859999 8:41448852-41448874 AGGTAGGTAGGTAGGTAGGCAGG + Intergenic
1041364948 8:57092208-57092230 AGTTAGATAAGGAGATGGTTGGG + Intergenic
1042524127 8:69746926-69746948 AGTTAGATAAGGAGGTGGTTGGG - Intronic
1045019805 8:98032150-98032172 AGGTAGGTAAGGAGGTGGTCTGG + Intronic
1045883983 8:107074477-107074499 AGGTGGATAAAGTGGTGGTCTGG - Intergenic
1048013474 8:130477389-130477411 AGGGAGGGAAGGAGGTGGGGAGG - Intergenic
1049528945 8:143143734-143143756 AGGTAGGTAGGCAGGTGGGTGGG + Intergenic
1050686997 9:8182954-8182976 AGGTGAGTTAGGAGGTGGTGGGG - Intergenic
1050687702 9:8190498-8190520 AAGCAGGTAAGCAGGTGCTCTGG - Intergenic
1051679440 9:19592489-19592511 AGGTAGGTAGGTAGGTGGGTAGG - Intronic
1052377437 9:27732920-27732942 AGTTAGATAAGGAGGTAGTTGGG + Intergenic
1053112113 9:35470212-35470234 AGGTGAGGAAGGAGGTGCTCAGG - Intergenic
1053144005 9:35699713-35699735 AAGTAGAGAAGGGGGTGGTCAGG + Intronic
1055327394 9:75145224-75145246 AGGTAGGTAAGTAGGTAGGTAGG - Intronic
1056129589 9:83570858-83570880 GGGTAGCAAAGGAGGTGGTGAGG + Intergenic
1057453885 9:95190250-95190272 AGGTAGGAGTGGAGGTGATCAGG - Intronic
1057564528 9:96156158-96156180 AGGCAGGTGAGGAGGGGCTCAGG - Intergenic
1057818249 9:98311569-98311591 AGTTAGGTCAGGAGGTCTTCAGG + Intronic
1058066405 9:100553388-100553410 GGGTAGGTAAGGCAGTGATCTGG + Intronic
1058220537 9:102294996-102295018 AGGTAGGTAGGTAGGTAGGCAGG - Intergenic
1059040137 9:110804856-110804878 AGGTAGGTAAGTAGGTTGGTAGG + Intergenic
1059733301 9:117077450-117077472 AAGTAAGTAAGGAGCTGGCCGGG + Intronic
1060059281 9:120444566-120444588 AGGTAGATAAGGAGGTGGTAAGG + Intronic
1060500616 9:124151124-124151146 AGATAGGTGAGATGGTGGTCAGG - Intergenic
1061967277 9:134022620-134022642 AGATAGGAAAGGAGATGGGCAGG + Intergenic
1185725329 X:2416056-2416078 AGTTAGGTTATGAGGAGGTCCGG - Intronic
1187668950 X:21649621-21649643 AGGTTGGGGAGGAGGTGGTGAGG + Intronic
1187669169 X:21651474-21651496 AGGTGGTTAAGAAGTTGGTCTGG - Intronic
1188052058 X:25499756-25499778 AGGTAGGTAAGGAGGTAGGTAGG - Intergenic
1188343301 X:29031992-29032014 AGGTAGGTAAGTAGGTAGGTGGG - Intronic
1190762199 X:53446060-53446082 AGCTAAGGAAGAAGGTGGTCAGG + Intergenic
1191857935 X:65642736-65642758 AGGTGTGTAAGGAGATGGTCAGG + Intronic
1192624984 X:72717088-72717110 AGGGAGGGAATGTGGTGGTCAGG - Intergenic
1194130457 X:90074578-90074600 AGGTAGCTAAAGAAGTGGTAGGG - Intergenic
1194966206 X:100291425-100291447 AGGAAGGAGAGGAGGTGCTCAGG + Intergenic
1195156258 X:102126529-102126551 ATGTAGGTAAGGGGATGGGCAGG - Intronic
1195447774 X:104973308-104973330 AGATGGGAATGGAGGTGGTCAGG + Intronic
1197639143 X:128948934-128948956 AGCTGGTTGAGGAGGTGGTCGGG - Intergenic
1197725208 X:129771613-129771635 AGGTAGGTAAGAAAAAGGTCTGG + Intergenic
1197768516 X:130074337-130074359 AGTTAGGTAAGGAGGGGTGCTGG - Intronic
1198271220 X:135057933-135057955 GGGAAGGTATGGAGGAGGTCGGG + Intergenic
1199610261 X:149606714-149606736 ATGTTGGTGAGGGGGTGGTCTGG - Intronic
1200012693 X:153131422-153131444 AGGTAGGTAGGTAGGTAGGCAGG + Intergenic
1200026907 X:153268495-153268517 AGGTAGGTAGGTAGGTAGGCAGG - Intergenic
1201575921 Y:15461196-15461218 AGGGAGTTGAGGAGGAGGTCAGG - Intergenic
1201714482 Y:17029434-17029456 AGGTAGGTAAGTAGGTTGAAAGG - Intergenic