ID: 1045028968

View in Genome Browser
Species Human (GRCh38)
Location 8:98117205-98117227
Sequence CGCACGAGCCCGCCCCCAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045028968_1045028973 1 Left 1045028968 8:98117205-98117227 CCCGCTGGGGGCGGGCTCGTGCG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1045028973 8:98117229-98117251 CATTCTGGGAACTGTAGTTTCGG 0: 1
1: 0
2: 6
3: 30
4: 288
1045028968_1045028975 21 Left 1045028968 8:98117205-98117227 CCCGCTGGGGGCGGGCTCGTGCG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1045028975 8:98117249-98117271 CGGCGACGCTCCAGGCCACGTGG 0: 1
1: 0
2: 0
3: 7
4: 66
1045028968_1045028976 24 Left 1045028968 8:98117205-98117227 CCCGCTGGGGGCGGGCTCGTGCG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1045028976 8:98117252-98117274 CGACGCTCCAGGCCACGTGGAGG 0: 1
1: 0
2: 2
3: 6
4: 78
1045028968_1045028974 13 Left 1045028968 8:98117205-98117227 CCCGCTGGGGGCGGGCTCGTGCG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1045028974 8:98117241-98117263 TGTAGTTTCGGCGACGCTCCAGG 0: 1
1: 0
2: 0
3: 0
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045028968 Original CRISPR CGCACGAGCCCGCCCCCAGC GGG (reversed) Exonic
904471278 1:30737943-30737965 CGCACCGGCCCATCCCCAGCTGG + Intronic
910200055 1:84690279-84690301 CGCGCGCGCCCGCCCCTTGCCGG + Intronic
914859088 1:151371997-151372019 CTCAAGAGCCAGCCCCGAGCGGG + Intronic
915894124 1:159798080-159798102 TGCACAAGGCTGCCCCCAGCTGG + Intergenic
1062877427 10:954315-954337 AGCAGGAGCCCTTCCCCAGCCGG - Intergenic
1064288705 10:14014140-14014162 CACCCGAACCTGCCCCCAGCTGG + Intronic
1065726076 10:28668880-28668902 CGCCCGAGCCCGCCCCTCCCCGG - Intergenic
1067406758 10:46030461-46030483 CGGACAAGCCCGGGCCCAGCGGG + Intronic
1067825839 10:49572301-49572323 CTTGCGAGCCAGCCCCCAGCTGG + Intergenic
1070162315 10:73873936-73873958 CGCCCGGCCCCGCCCCCCGCGGG - Intronic
1073051673 10:100671173-100671195 CGCACGCGGCCGCCCCCTGGTGG - Intergenic
1073577520 10:104639058-104639080 CGCCCGATCCCGCGCCCACCTGG + Intergenic
1080418492 11:32091039-32091061 CGCCAGTGCCCGCCCCGAGCCGG - Exonic
1083931650 11:65849625-65849647 CGCAGGAGGCCTCCCCCAGGGGG + Intronic
1090201538 11:124861349-124861371 AGCAGGAGCCTGCCCCCGGCAGG - Intergenic
1091789686 12:3264597-3264619 CGCACTGCCCCGGCCCCAGCCGG - Intronic
1101479671 12:105084653-105084675 GTCAAGACCCCGCCCCCAGCTGG + Intergenic
1101874547 12:108589788-108589810 TGCAAGAGCCCCTCCCCAGCAGG + Intergenic
1103415505 12:120739689-120739711 CCCACAACCCCGCCCCCAGGAGG - Exonic
1104602540 12:130162975-130162997 CGCACGAGCCCATCACCTGCAGG - Exonic
1111333547 13:86792321-86792343 CCGACGAGCCCACCCCCAACCGG - Intergenic
1113697401 13:112355758-112355780 CACAGGAGCCCACCCCAAGCTGG + Intergenic
1118306312 14:64658235-64658257 CGCCCGAGCCCACGCCCACCAGG - Intergenic
1118716614 14:68564448-68564470 CTCACAAGCCCGTCCCCTGCTGG - Intronic
1120765957 14:88326606-88326628 TGCACTCGCCGGCCCCCAGCAGG + Intronic
1124251105 15:28106941-28106963 GGCCAGAGCCCGCTCCCAGCAGG - Intergenic
1125688114 15:41575606-41575628 CACACCAGCACACCCCCAGCAGG - Intronic
1127868288 15:63048846-63048868 CCCCAGAGCCCGCCGCCAGCTGG - Intronic
1129763976 15:78149501-78149523 CCCACGCGCCCGCCCACACCCGG - Intronic
1131257545 15:90871984-90872006 CTCCCCATCCCGCCCCCAGCAGG - Intronic
1134490868 16:14694357-14694379 CCCAGGTGCCCGCCCCTAGCTGG - Exonic
1134496249 16:14733475-14733497 CCCAGGTGCCCGCCCCTAGCTGG - Intronic
1134641045 16:15829564-15829586 CCCACGAGCCCCTCTCCAGCTGG + Intronic
1135407031 16:22206204-22206226 CTCACGTGGCCGCCCCCAGGTGG - Intergenic
1135572289 16:23558071-23558093 CGCACGAGGCAGCCTGCAGCCGG + Exonic
1136129610 16:28211664-28211686 CGCCCGGGCCCGACCCCCGCGGG + Exonic
1136146811 16:28320952-28320974 AGCCCGGGCCCGCCCCGAGCCGG + Exonic
1142283375 16:89160821-89160843 CGCACCAGCCCGCCCTGGGCGGG + Intergenic
1145007987 17:19348249-19348271 CCCATGAGCCCGCCTCCATCAGG - Intronic
1147167741 17:38602420-38602442 TGCACCAGCCCACCCACAGCAGG + Intronic
1148582427 17:48752930-48752952 CCCCCGAGCCTGCCCCCACCCGG - Intergenic
1151313981 17:73311001-73311023 CGCGCGCACCCGCCCCAAGCGGG + Intronic
1157706788 18:49813932-49813954 CGTTCGGTCCCGCCCCCAGCTGG - Exonic
1160662773 19:308738-308760 CCCACGTGCCCACCCCCGGCGGG + Intronic
1160853841 19:1207072-1207094 CGTAAGAGCCTTCCCCCAGCAGG - Exonic
1160895850 19:1401515-1401537 CGCCCGGGCCCGCTCCCTGCAGG + Exonic
1161628749 19:5340836-5340858 CGCTCGCGCGCCCCCCCAGCCGG + Intergenic
1162022505 19:7874218-7874240 GGCCCGACCCCTCCCCCAGCCGG + Intronic
1162799481 19:13102940-13102962 CTCCCGGCCCCGCCCCCAGCCGG + Intronic
1165861620 19:38912089-38912111 CGCACTCACCCGCCCCCAGCAGG + Exonic
1165928476 19:39342060-39342082 CGCGCGAGCCTGCCCCCTGCGGG + Intronic
1166739098 19:45103445-45103467 CACACGAGTCCGACCCCGGCGGG - Intronic
1167258144 19:48443136-48443158 CGCCCGCGCCTGGCCCCAGCAGG - Exonic
925164840 2:1709616-1709638 CGCACCTGCCCGGCCCCAGGAGG + Intronic
925188147 2:1863634-1863656 CGCTCCAGCCCGACCCCAGGAGG + Intronic
926474791 2:13308594-13308616 CCCCCGAGCCCACGCCCAGCCGG + Intergenic
926606524 2:14903956-14903978 CGCTCGATGCCGCCCCCTGCAGG - Intergenic
944473753 2:200083370-200083392 CCAACGTGCCCGGCCCCAGCTGG - Intergenic
944831139 2:203535047-203535069 CTCACGGCCCCGCGCCCAGCCGG + Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
1169559865 20:6787965-6787987 CCCACTACCCCACCCCCAGCTGG - Intergenic
1171175894 20:23050497-23050519 CCCACGCGCCCGCCCCTACCCGG - Intergenic
1175847411 20:62065918-62065940 CGCGCGCCCCCGCCCCCCGCCGG - Intergenic
1176549283 21:8214468-8214490 CGCCGGAGCCCGCCCCCTCCGGG - Intergenic
1176557176 21:8258691-8258713 CGCCGGAGCCCGCCCCCTCCGGG - Intergenic
1176568215 21:8397506-8397528 CGCCGGAGCCCGCCCCCTCCGGG - Intergenic
1176576118 21:8441726-8441748 CGCCGGAGCCCGCCCCCTCCGGG - Intergenic
1181478295 22:23181605-23181627 CGCTCGAGCCCGCGCCGTGCTGG - Exonic
1181571057 22:23767992-23768014 CTCAGGAACACGCCCCCAGCGGG + Exonic
1181592368 22:23893358-23893380 GGCACCAGCCAGCCTCCAGCTGG - Intronic
1184645254 22:45891722-45891744 CACACGCGCCCGCGCCCCGCGGG + Intergenic
1203254168 22_KI270733v1_random:130784-130806 CGCCGGAGCCCGCCCCCTCCGGG - Intergenic
1203262224 22_KI270733v1_random:175863-175885 CGCCGGAGCCCGCCCCCTCCGGG - Intergenic
954378289 3:50206099-50206121 TGCAAGAGCCCGCCCCCGCCCGG + Intronic
955687401 3:61561454-61561476 AGCGCGCGCCCGCCGCCAGCTGG + Intergenic
961381649 3:126499635-126499657 CGCCAGAGCCCGCCACCTGCAGG + Intronic
962280579 3:134048903-134048925 CCCAGGGGCCCGCCCCCACCAGG + Intronic
968567215 4:1319432-1319454 CGTACGAGCCTGCTGCCAGCTGG + Intronic
968664856 4:1815396-1815418 CCCTGGACCCCGCCCCCAGCTGG - Intronic
968871913 4:3246670-3246692 GGTACGAGCCCCTCCCCAGCAGG + Intronic
980958761 4:139454107-139454129 CGCAAGAGCGCGCGCCCAGCCGG - Exonic
985767542 5:1787748-1787770 TCCAGGAGCCCGCCCCCAGGAGG - Intergenic
985988385 5:3536064-3536086 TGCAAGAGGCCGCCCCCGGCAGG + Intergenic
998920823 5:147065861-147065883 CTCACGGACCCGCACCCAGCAGG - Intronic
1002422417 5:179155516-179155538 CGCACCAGCCAGCCCCCTGCTGG - Intronic
1010752597 6:79631612-79631634 CGCGGGAGCCCGCGCCCGGCAGG + Intronic
1017815959 6:158016910-158016932 CCCAGGTGCCTGCCCCCAGCTGG + Intronic
1018400442 6:163415005-163415027 CGCGCTCGCCCGCCCCCCGCAGG - Exonic
1019291749 7:253933-253955 CGGACGAGGCAGCCCCCACCGGG - Intronic
1021845306 7:24757468-24757490 CCCAAGCGCCCGCCCCCCGCCGG - Intronic
1021998563 7:26202375-26202397 CGCGGGTGCCCGCCCCCACCCGG - Intronic
1025078697 7:55964534-55964556 CGCGCGACCCCTCCCCCGGCCGG - Intronic
1029423387 7:100483344-100483366 CGCCGGAGCACGCCCCCTGCTGG + Intergenic
1029489245 7:100861425-100861447 GGCAGGAGGCCACCCCCAGCAGG - Exonic
1034950947 7:155297176-155297198 GGCACGGGCCCGCCCTCAGACGG + Intergenic
1038425321 8:27460818-27460840 TGCACCAGCCGGCCCCCAGGAGG - Exonic
1045028968 8:98117205-98117227 CGCACGAGCCCGCCCCCAGCGGG - Exonic
1049109542 8:140634976-140634998 CGCCCGTGCGCGCCCCGAGCCGG + Intronic
1049212235 8:141392101-141392123 CGCGCGCCCCCGCCCCGAGCGGG - Intronic
1049429183 8:142551288-142551310 AGCCAGAGCCCGCCCCCTGCTGG + Intergenic
1049803102 8:144527205-144527227 CGCTCGGCCCCGCCCCCACCCGG - Exonic
1052389852 9:27866931-27866953 GGCAGGAGCCCACCCCCAGGGGG + Intergenic
1057131291 9:92656176-92656198 CTCAAGAGCCCTCACCCAGCAGG + Intronic
1061045004 9:128160198-128160220 CGCCCCGCCCCGCCCCCAGCCGG - Intergenic
1061108790 9:128552519-128552541 CGCTCGCGCCCGCCCGCCGCGGG + Intergenic
1061221221 9:129253366-129253388 CGCAGGAGTCAGCGCCCAGCGGG - Intergenic
1062627095 9:137448290-137448312 CGCCCCAGCCCTCCCTCAGCTGG + Exonic
1203470569 Un_GL000220v1:113928-113950 CGCCGGAGCCCGCCCCCTCCGGG - Intergenic
1203478390 Un_GL000220v1:157900-157922 CGCCGGAGCCCGCCCCCTCCGGG - Intergenic
1200244486 X:154515877-154515899 CGATCGCGCCCGCCCCCAGCAGG - Exonic