ID: 1045031224

View in Genome Browser
Species Human (GRCh38)
Location 8:98138321-98138343
Sequence CAGGGTGGCTGAAGTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045031224_1045031225 -10 Left 1045031224 8:98138321-98138343 CCTTCTACACTTCAGCCACCCTG 0: 1
1: 0
2: 4
3: 34
4: 321
Right 1045031225 8:98138334-98138356 AGCCACCCTGACCTTCTTTCAGG No data
1045031224_1045031229 -4 Left 1045031224 8:98138321-98138343 CCTTCTACACTTCAGCCACCCTG 0: 1
1: 0
2: 4
3: 34
4: 321
Right 1045031229 8:98138340-98138362 CCTGACCTTCTTTCAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045031224 Original CRISPR CAGGGTGGCTGAAGTGTAGA AGG (reversed) Intronic
900724796 1:4208883-4208905 CATGGTGGATGAAGTGGCGAAGG - Intergenic
901358557 1:8674943-8674965 CTGGGAGGCTGAAATGTAAATGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903074239 1:20750094-20750116 TAGGGTGGATGGAGGGTAGATGG - Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904369376 1:30038775-30038797 CAGGGTGGCAGACTTGTAAATGG - Intergenic
904575119 1:31500426-31500448 CAGGGTGGCCGAGGTTTAGAGGG + Intergenic
904954733 1:34273465-34273487 CTGCTTTGCTGAAGTGTAGAAGG + Intergenic
906114860 1:43349604-43349626 CAGTTTGGCTGAAGGGTGGACGG - Intronic
906494961 1:46298763-46298785 AAGTGTGGCTGAAATGTAGGAGG - Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906811948 1:48836099-48836121 CAGGGTGGTGGCAGTGGAGATGG + Intronic
907869196 1:58427514-58427536 CAGGGTGGCAGCAGTGCAGCTGG + Intronic
908040216 1:60104697-60104719 CAGGGAGGCTAAAATGTAGGGGG - Intergenic
909101752 1:71357490-71357512 CAGGGTGGTTGGAGGGTATAGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
911463738 1:98224210-98224232 CAGTGTGGCTGAAGCATAAAAGG + Intergenic
912358405 1:109074043-109074065 CAGGGTGGCGGCAGGGCAGAGGG - Intronic
912503120 1:110135637-110135659 CAGGATGGCATAAGTGAAGAAGG + Intergenic
912916822 1:113823842-113823864 CATGATGGCTGAAGTATAGTTGG - Intronic
914732897 1:150388004-150388026 TAGGATGGCTGAAGTCTAGGAGG - Intronic
915921295 1:159977762-159977784 CTGTCTGGCTGAGGTGTAGATGG - Intergenic
916271669 1:162949748-162949770 CCAGGTGGCTGAATTGTTGAAGG - Intergenic
916283045 1:163073888-163073910 CAGGTTGGCTAATGGGTAGAAGG - Intronic
916671958 1:167029765-167029787 CGGGGTGGCTGCCGGGTAGAGGG - Intergenic
917462200 1:175241749-175241771 CAGGGTGGTGGAAGTTTTGAGGG - Intergenic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
918114850 1:181486790-181486812 CAGCGTGCCTGAAGTGGGGAGGG + Intronic
918180388 1:182081920-182081942 CAGGATGGCTGGAATGTAGCAGG + Intergenic
918239217 1:182607005-182607027 CATGGAGGCAGAAGTCTAGATGG + Intergenic
918649632 1:186945252-186945274 CCGTGTGGCTGAAGTGAAGTGGG + Intronic
920952942 1:210589858-210589880 CAAGGTACCTGAATTGTAGATGG - Intronic
923142604 1:231173651-231173673 CAGAGAGGCAGAAGTGTACAGGG + Intronic
923271255 1:232357161-232357183 CGGGGTGGCTGCAGTGGAGGTGG + Intergenic
924027462 1:239850323-239850345 CTGAGTGGCTGAAGAGGAGAAGG + Intronic
1063099178 10:2934783-2934805 TTGGGGGGCTGGAGTGTAGAGGG + Intergenic
1063430465 10:5984113-5984135 AGGCGTGGCTGAAGTGTGGATGG - Intergenic
1063615013 10:7593500-7593522 CTGGGTGGCTGCAGTCTACAGGG - Intronic
1064365803 10:14706777-14706799 CACGATGGCTGAAGAGTAGAAGG - Intronic
1064490437 10:15850319-15850341 CAGGATGGCTGCAGTGTTCAGGG + Intronic
1066231224 10:33435752-33435774 CAGGGTGGTTGCAGGGTGGAGGG - Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070280631 10:75045660-75045682 CAGTGTGGCTGAAGTGGCAAGGG + Intronic
1070586512 10:77770840-77770862 CATGGGAGCTGAAGTGCAGATGG + Intergenic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1071496728 10:86172928-86172950 GAGGGTGGGTGAGGTGTAGGTGG - Intronic
1072904941 10:99444481-99444503 CAGCGAGGCTGAGTTGTAGATGG - Intergenic
1073479582 10:103778018-103778040 CATGGTGGCTGAAGTTAAAAAGG + Intronic
1074425663 10:113349053-113349075 CAGCGTGGCTGTAGTGTAAGAGG + Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1077350938 11:2092924-2092946 CAGGGTGGCTGCAGAGGGGATGG - Intergenic
1077898027 11:6468671-6468693 CAGAGTGACTGAAGAGTAAATGG + Intronic
1078437940 11:11340866-11340888 CAGGGTGGCTGAAGTCTGGATGG - Exonic
1079539984 11:21561445-21561467 TAGGGTGGCTGAAATATAGCAGG - Intronic
1081444412 11:43116691-43116713 CAGGGAGGCTGAAGTAGGGATGG + Intergenic
1081631653 11:44693782-44693804 CTGCGTGGCTTAAGTGAAGAAGG + Intergenic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1083698009 11:64455546-64455568 CGGGGTGTCTGTAGTGGAGAGGG + Intergenic
1085154809 11:74283663-74283685 CTTGGTGGCTGAAGTGTGCAAGG - Intronic
1088117736 11:106331897-106331919 GAGGGTTGCTTAAGTCTAGAAGG - Intergenic
1088342141 11:108780265-108780287 CAGGGTGGCTGAAGTTAAAGAGG + Intronic
1088893933 11:114064008-114064030 TGGGGTGGCTGAGGTGAAGACGG + Exonic
1089514550 11:119024227-119024249 TGGGGAAGCTGAAGTGTAGATGG - Intronic
1089744202 11:120605718-120605740 CAGCGTGGCTGAAGGGCAGGGGG - Intronic
1090620179 11:128553677-128553699 GAGGGTGGCGGGAGTGTGGAGGG - Intronic
1090990491 11:131812759-131812781 AAGGGAGGCCGAAGTGGAGAGGG + Intronic
1091365444 11:135016117-135016139 CTGGCTGGGTGAAGTGTGGAGGG - Intergenic
1091752805 12:3033166-3033188 CAGGGAGGCTGGACTGGAGACGG - Intronic
1091829118 12:3536666-3536688 CCTGGTGGCTGAGGTGTGGAGGG + Intronic
1092268074 12:6998753-6998775 CAGGATTGCTGGAGTGTGGAAGG - Intronic
1093512273 12:19943536-19943558 CAGGGTGGTTGAAGTGAACCTGG + Intergenic
1095276934 12:40296940-40296962 TAGGTTGGCTGGAGGGTAGAAGG - Intronic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1100625501 12:96327386-96327408 TAGGGTGGCTGTACTGAAGATGG + Intronic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1101059908 12:100959949-100959971 CAGGATGGCAGAAGTGGAGGAGG + Intronic
1101580928 12:106040336-106040358 GAGGGAGGCTGAGGTGTTGAGGG - Intergenic
1101787203 12:107894559-107894581 CAGGGAGGGGGAAGTGGAGATGG - Intergenic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1105600936 13:21886206-21886228 TTGGGTGGCGGAAGTGGAGATGG + Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1106044877 13:26129639-26129661 CAGTGTGACTGCTGTGTAGAGGG - Intergenic
1106810268 13:33351885-33351907 AAGTGTAGCAGAAGTGTAGAGGG - Intergenic
1108056071 13:46486713-46486735 CAGGGAGGCAGAAGTGAAGCAGG - Intergenic
1108727711 13:53200741-53200763 CACGGTGGCCGAAGTGGAGCTGG + Intergenic
1112607324 13:100919760-100919782 CTGGCTGGCTGAATTGTACATGG + Intergenic
1112681477 13:101771111-101771133 CATGGGGGCTGTAGTGCAGAAGG + Intronic
1113618605 13:111698173-111698195 CAGGGAGGCTGTGGTGTTGATGG + Intergenic
1113624134 13:111783434-111783456 CAGGGAGGCTGTGGTGTTGATGG + Intergenic
1113739866 13:112704132-112704154 CATGGTGGCTGACGTGTGGGTGG - Intronic
1113864586 13:113512651-113512673 GAAGGGGGCTGGAGTGTAGATGG + Intronic
1115459997 14:33649879-33649901 CAGAGTGGTTGTAGTGTGGAAGG + Intronic
1115618319 14:35117546-35117568 CAGTGAGGCTGAAGTGGAAATGG - Intronic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1120547586 14:85829856-85829878 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121557031 14:94846024-94846046 AAGGGAGGCTGAAATATAGAAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122988058 14:105221700-105221722 CAGGCTGGCTGCAGTGGGGAGGG + Exonic
1123185259 14:106510613-106510635 CAGGATGGCTGTAGTGGAGGAGG + Intergenic
1124271627 15:28287413-28287435 CAGGGTGGCTTTAATGAAGAGGG - Intronic
1125679897 15:41524022-41524044 TGGGGTGGCTGGAGTGTAAAGGG - Intronic
1125807483 15:42506278-42506300 CAGGCAGGCTGGAGTGTAGTGGG + Intronic
1125887246 15:43238139-43238161 CAGGGTGGCTGAAGGGCGGTGGG - Intronic
1126404826 15:48313287-48313309 CAGAGAGGCAGAAGTGGAGATGG - Intergenic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1130137380 15:81192802-81192824 GAGGGTGGCGGCAGTGAAGATGG + Intronic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131721823 15:95177597-95177619 CAGTGTGGCTAAAGGGTATATGG - Intergenic
1132006193 15:98229568-98229590 CAGGGGTGCTGATGTGTATAAGG + Intergenic
1132645156 16:995895-995917 TAGGATGGCTGAAGTTCAGAGGG + Intergenic
1132663315 16:1071041-1071063 CAGGGTGGCCGATGTGGGGAGGG + Intergenic
1133297168 16:4760227-4760249 CAGGGAAGCTGAAGTGAAGTAGG + Intronic
1134187590 16:12096903-12096925 TAGGGTGGCTGAGGTCCAGAGGG + Intronic
1134205296 16:12232726-12232748 CAGGATGGCTGCAGCCTAGAGGG + Intronic
1134302781 16:13006379-13006401 CAGGTTGGCTGATATGTTGACGG - Intronic
1134739205 16:16527590-16527612 CAGGGCAGCTGAAGTGGAGTGGG - Intergenic
1134928295 16:18184561-18184583 CAGGGCAGCTGAAGTGGAGTGGG + Intergenic
1135429080 16:22366871-22366893 CAGGGTGGCAGAGATGAAGATGG + Intronic
1136222737 16:28838699-28838721 CAGGATATTTGAAGTGTAGATGG + Intergenic
1137633529 16:49965808-49965830 CCGGGTGGCTGCAGTCTACATGG + Intergenic
1137792794 16:51188981-51189003 CTGTGGGGCTGAGGTGTAGATGG - Intergenic
1138419948 16:56892623-56892645 CAGGGGGCCTGAAGTGCAGGCGG + Intronic
1139658470 16:68403958-68403980 CAGGGAGGCTGAGGTGCAGCTGG + Intronic
1141917144 16:87106841-87106863 TATGGTGGCTGGAGAGTAGAGGG + Intronic
1142405126 16:89884273-89884295 CAGGGTGGCTGCAGTGTGGCAGG + Intronic
1142431119 16:90027939-90027961 CAGGGTGGTAGGAGTGTGGAAGG + Intronic
1143709147 17:8721900-8721922 CAGGGTAGCTGGAATGAAGAGGG - Intergenic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143903090 17:10189292-10189314 CAGGGTGGTGGAAGTGGAGATGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145392023 17:22462416-22462438 GAGGGTTGCTGGAGTGAAGAAGG - Intergenic
1145791870 17:27632479-27632501 CAGGGTGGCTGAGGTGTCATTGG - Intronic
1146411280 17:32587752-32587774 AAGGGAGGCTGAAGAGCAGAGGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147946869 17:44085275-44085297 CAGGGTGGCTGCAGTGGCCATGG - Intronic
1151582588 17:74988511-74988533 GAGGGTGGCTTGTGTGTAGAGGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152665490 17:81566440-81566462 CAAGGTGGCTCTGGTGTAGAGGG + Intronic
1203167025 17_GL000205v2_random:106846-106868 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1155016282 18:21843934-21843956 CAGGGTTGGAGAAGAGTAGAAGG + Intronic
1156080705 18:33331356-33331378 CAGGATGGCTGAAGAGCAAAAGG - Intronic
1156482519 18:37445204-37445226 CAGGGTCTCTGAAGTGTGGTGGG - Intronic
1157125146 18:44949856-44949878 AAGGGTGGGTGGAGTGGAGAGGG - Intronic
1157422048 18:47555676-47555698 CAGGGTGGGGGATGTGTGGAAGG - Intergenic
1157784698 18:50471057-50471079 CAGGGTAGCTGGAGTGAGGATGG - Intergenic
1158475253 18:57774059-57774081 CAGGGTGGCTGTAGATGAGAGGG - Intronic
1160124250 18:76155817-76155839 CAGGGTGTTGGAAGGGTAGATGG - Intergenic
1162531169 19:11237232-11237254 CAGGGTGGCTAAAGTGGGAATGG + Intronic
1162807218 19:13144294-13144316 CTGGGTAGCTGGAGAGTAGAGGG - Exonic
1163383591 19:16985475-16985497 AAGGGTGGATGAAGGGCAGACGG + Intronic
1164854551 19:31511071-31511093 CAGGGTCGCTCATGTGCAGAGGG + Intergenic
1165467489 19:35983656-35983678 CAGGGTGGCTGCAGTGCACTGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
925094798 2:1187999-1188021 AAGGGCGGCTGGAGAGTAGAGGG + Intronic
925663085 2:6223397-6223419 CAGGGTCCCTGCAGTGCAGAGGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
929020691 2:37549683-37549705 CAGGGTGGCTGAAGGAAACATGG - Intergenic
929171104 2:38934392-38934414 CAGGGTGGCTTGAATGCAGAGGG - Intronic
929527802 2:42722066-42722088 CAGGGTGGCTTGTGTGTAGTTGG + Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931385740 2:61795942-61795964 CAGGGAGCCTGAAGTGTAAGGGG - Intergenic
931415204 2:62074077-62074099 CAGGTAGGGTGAAGTCTAGAAGG + Intronic
932059318 2:68479816-68479838 CAGGGTGGCAAAGGTGTAAAAGG - Intronic
932745395 2:74329826-74329848 GATGGGGGGTGAAGTGTAGATGG + Intronic
932861991 2:75304015-75304037 CAGGCTGGCTGTGGGGTAGAGGG - Intergenic
934791593 2:97067023-97067045 CAGGGTGGATGCAGAGTGGAGGG - Intergenic
934937129 2:98473513-98473535 CAGTGTAGGTGCAGTGTAGAGGG + Intronic
936295021 2:111261378-111261400 CAGGGTGGATGCAGAGTGGAGGG - Intergenic
936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG + Intergenic
937891833 2:126945080-126945102 CAGGGTGCCTAAAGTGTGGCAGG - Intergenic
938153734 2:128909782-128909804 CAGATTGGCTAAAGTTTAGAGGG - Intergenic
938798842 2:134741296-134741318 CAGGGTGGCTGGAGTATGGTGGG + Intergenic
940919038 2:159287139-159287161 CAGGGTGGCCGAAATAGAGAAGG - Intergenic
941287714 2:163634482-163634504 CAGTTTGGCTGTGGTGTAGATGG - Intronic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
941786627 2:169505750-169505772 CAGGGTGGCTGCTGGGCAGAGGG - Exonic
943411726 2:187556692-187556714 CAGGGTGGCTGCTGGGCAGAGGG - Intronic
943473793 2:188329519-188329541 CTGGGTGGCTGAAATGAAGTGGG + Intronic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
945136944 2:206639624-206639646 AAGGGTGGCAGCAGTGGAGAGGG - Intergenic
945316663 2:208377616-208377638 CAGGGTGGCTGCTGGGCAGAGGG + Intronic
947855156 2:233319020-233319042 CAGGGTGGCAGATAAGTAGATGG + Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948807118 2:240457806-240457828 CAGGGTGGCTGGAATGCAGCAGG - Intronic
948826401 2:240575306-240575328 CAGGGTGGCAGAAGGGGAGGTGG - Intronic
1171157597 20:22890653-22890675 CAGAGTGGCTGAGGTCCAGATGG - Intergenic
1171489227 20:25504793-25504815 ATGAGTGGCTGAAGGGTAGAGGG + Intronic
1171952863 20:31437055-31437077 CAGCGTGGCTGAAGAGTAGTGGG + Intergenic
1172969264 20:38861589-38861611 CAGGCTGGCTGAAGGGTGGGGGG - Intronic
1173343369 20:42175302-42175324 CAGTGTGGCTGCAGCCTAGAGGG - Intronic
1174171059 20:48618533-48618555 CGGGCTGGCTGAAATGTTGAAGG - Intergenic
1175798081 20:61784970-61784992 CAGCGTGGCTCAGGTGTAGAAGG - Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176334542 21:5583714-5583736 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1176393215 21:6237234-6237256 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1176468204 21:7078940-7078962 CAGGTTGGCAGGAGGGTAGAAGG + Intronic
1176491765 21:7460718-7460740 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1176508877 21:7677665-7677687 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1177187711 21:17816752-17816774 CAGGGTTGCTGTAGTGGTGATGG - Intronic
1177326905 21:19602354-19602376 AAGTGTTGCTGCAGTGTAGATGG + Intergenic
1179320999 21:40291186-40291208 CAGGGTGACTGCAGTGGAGGAGG - Intronic
1179982617 21:44904190-44904212 CAGGGGGGCTGAAGGCTGGAGGG - Intronic
1181536978 22:23551403-23551425 AAGGATGGATGAAGTGTGGATGG - Intergenic
1181671444 22:24427343-24427365 CAGGGTGGCTGCAATGAGGATGG - Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1183875116 22:40773658-40773680 CAGGGTGACTGAAGTATAGAAGG + Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951305304 3:21053159-21053181 CAGGGTGGAGGAAGTGAGGAGGG + Intergenic
958037617 3:88189030-88189052 CAAGGTGGTGGAAGTGGAGAGGG + Intergenic
959029707 3:101283999-101284021 CAGGGTGGTGGCAGTGAAGATGG + Intronic
959590877 3:108079307-108079329 TTGGGTTGCTGAGGTGTAGAAGG - Intronic
961227121 3:125261012-125261034 CAGGGTGGGGGAAGTGTTGGAGG + Intronic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
964616497 3:158672370-158672392 CAGGGTGTTTGAGGTGCAGAAGG - Exonic
965439030 3:168690743-168690765 CAGGATGGCTGAACTGCTGAAGG + Intergenic
966865841 3:184258877-184258899 CAGGCTGGCTGGTGTGCAGAGGG - Intronic
967129556 3:186458166-186458188 CAGTGTGGCTGAATTGTTGTTGG + Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
969340357 4:6536629-6536651 CAGGGTGGGTGCAGTGGAGAAGG + Intronic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969988052 4:11231883-11231905 CAGGGTGTCTGAAGTGCAGTGGG - Intergenic
970959790 4:21858111-21858133 AAGGGTGACTGAAGTGGTGAGGG - Intronic
971046191 4:22807757-22807779 TTGGGTGGCTTAAGTGAAGATGG - Intergenic
971489371 4:27194837-27194859 CAGAGTGGGTGAAGGGGAGATGG + Intergenic
972827319 4:42774728-42774750 CAGGGTGGGGAAAGTGTAGGAGG + Intergenic
972938483 4:44168065-44168087 CAGGGTGGCGGCAGGGCAGAGGG - Intergenic
978356597 4:107881735-107881757 CAGGGCGGGTGAAGTAGAGATGG - Intronic
980539359 4:134173569-134173591 CAGGGAGGATGAAGAGTGGATGG + Intergenic
980626389 4:135380120-135380142 TAGGGTTGCTGAAGTGTATTGGG + Intergenic
982247615 4:153369688-153369710 GATGGTTGCTGAAGGGTAGATGG + Intronic
982353747 4:154444525-154444547 CAGGGTGGTAGAAGTGGAGGTGG - Intronic
983977778 4:173956282-173956304 CAGGGTCGATGAAGTGAAAAAGG - Intergenic
985235034 4:187863094-187863116 CAGGGTGGCAGTCGTGAAGACGG + Intergenic
985662188 5:1162760-1162782 CAGGGTGGGTGACGTGCAAAGGG + Intergenic
988371383 5:30372333-30372355 CAGCGAGGCTGCAGTTTAGATGG + Intergenic
989453618 5:41615843-41615865 CAGGGTATCTGAAGTGTAGTGGG - Intergenic
991448090 5:66721957-66721979 CAGGGTAGCAGCAGTGCAGAAGG - Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
991934595 5:71789412-71789434 CAGGGTGGTAGCAGTGGAGATGG + Intergenic
992201009 5:74383973-74383995 CAGGGTGGATGAGGAGGAGAAGG + Intergenic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
995415870 5:111912347-111912369 CAGGGTGGATGAAGTGAGGAGGG - Intronic
995641286 5:114260083-114260105 TAGGGTGGTAGAAGTGGAGATGG - Intergenic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
997588783 5:135060417-135060439 CAGGGTGGCTGAAGTCTCTGGGG + Intronic
997990588 5:138542356-138542378 CCGGGTGGGTGAAGTTTGGATGG - Intronic
999722550 5:154409549-154409571 GCGGGTGGCCGAAGTGTGGATGG + Exonic
1001100309 5:168808836-168808858 CAGGGTGTTTGAAGTACAGATGG + Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001765805 5:174246026-174246048 CAGATTGGCTGAAATGAAGACGG + Intergenic
1002600382 5:180351407-180351429 CAGGGTGGGGGAAGTGGGGAGGG - Intronic
1003279089 6:4676464-4676486 CAGGGTGGCTGATGAGTAGCTGG - Intergenic
1003902024 6:10663275-10663297 CAGGGTGGATGTGGTGTATACGG - Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1004906041 6:20238287-20238309 CAGGATGGCTTAATAGTAGAAGG - Intergenic
1007246947 6:40469863-40469885 CAGGGTGTGTGCAGGGTAGAGGG - Intronic
1007464952 6:42045190-42045212 CAGGGAGGCTGAAATATAAAGGG - Intronic
1007825884 6:44600320-44600342 CAGGGTGGATGCAGTGTAGGAGG - Intergenic
1008560558 6:52720692-52720714 GAGCTTGGCTGAAGAGTAGAGGG - Intergenic
1009676200 6:66825620-66825642 GAAGGTGGCTGAAGAGGAGAAGG - Intergenic
1009960900 6:70519570-70519592 CAGGGTGGCTGCAGTGGCTATGG - Intronic
1010439412 6:75875996-75876018 CAGGGTGACTGAAGGAGAGAAGG - Intronic
1012144913 6:95669383-95669405 TAAGGTAGCTGAAGTGTACAGGG - Intergenic
1013303669 6:108828256-108828278 CAGGGTGGCTAAAATCTAAAAGG + Intergenic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014450979 6:121581449-121581471 CAGGGTGGCTGAATATTAGGGGG - Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015435881 6:133187491-133187513 GATGATGTCTGAAGTGTAGATGG + Intergenic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1016123571 6:140373749-140373771 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1017467471 6:154707787-154707809 CAGTCTGGCTGAAGTGGAGGAGG + Intergenic
1018059378 6:160078717-160078739 CTGGGTGGCTGAAATCTACAGGG + Intronic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019159882 6:170062717-170062739 CAGTGTGGCTGATGTGCACAGGG - Intergenic
1019655279 7:2190769-2190791 CAGGATGGCTAAAGTGAAGGTGG + Intronic
1022177462 7:27885411-27885433 AGGGGTGGCAGAAGTGAAGATGG - Intronic
1022485364 7:30773502-30773524 CAAAGTGGTTGAAGGGTAGAGGG - Intronic
1022765786 7:33409813-33409835 CACGGTGGCAGAAATGTATATGG - Intronic
1023311628 7:38893198-38893220 CAATGTGGCTGTAGTGTAGAAGG - Intronic
1024530008 7:50383755-50383777 CAGGGTGGGTGAGGAGTAGCTGG - Intronic
1024753521 7:52500021-52500043 CATGGTGGCTGCAGTGTGGAGGG - Intergenic
1026166622 7:67915880-67915902 CAGGGTTGCTGAAGTGAGGGAGG - Intergenic
1028739231 7:94253124-94253146 CAGGATTGCTGAAGTGATGAAGG + Intergenic
1030166475 7:106560685-106560707 CTGGCTGGCTGAGGTGAAGAAGG + Intergenic
1030333934 7:108303379-108303401 CAGAGGGGCTGAAGAGGAGACGG - Intronic
1031697270 7:124873914-124873936 CAAGGTGGCTACAGTGAAGATGG + Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032681887 7:134193784-134193806 CTGGGTGGCTGCTGTGTAGAGGG - Intronic
1034407072 7:150911733-150911755 CAGGGTGGCTCAAGTGTCCCTGG - Intergenic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1037102753 8:15067238-15067260 CAGGGTGGGTGTAGTGTGCAGGG - Intronic
1041677297 8:60548883-60548905 CAGGGTGGCTGCCGGGCAGAGGG + Intronic
1042091631 8:65165549-65165571 GAGGGTTTCTGAAATGTAGATGG + Intergenic
1042844107 8:73153477-73153499 CAGGGTGGAAGAAGTGAAGGGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043167703 8:76925091-76925113 CAGGTTTGCTGAAGTAAAGAGGG + Intergenic
1043370015 8:79580136-79580158 CAGGGAGGCTGCAGTGGAGCAGG + Intergenic
1044379696 8:91520077-91520099 CACAGTGCCTGAAATGTAGAAGG + Intergenic
1044744765 8:95361503-95361525 CAGGGTGGCTGAGGTGGGAATGG + Intergenic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047401012 8:124547578-124547600 TAGGGTGGATGAAGTGGATATGG + Intronic
1047718912 8:127620526-127620548 TAGGGTGGCTGAGGTGGAGCGGG + Intergenic
1047818859 8:128495959-128495981 CAGGGTATCTGGAGTGTAGGAGG - Intergenic
1048192339 8:132301335-132301357 CATGGTGGCTGGAGTGGACAGGG - Intronic
1049474888 8:142792493-142792515 ACGGATGGATGAAGTGTAGATGG - Intergenic
1049713312 8:144077348-144077370 CAGAGTGGCTGTAGAGCAGAGGG + Intergenic
1049811427 8:144575247-144575269 GAGTGTGGCCGAAGTGTACAGGG - Intronic
1050297263 9:4218240-4218262 CATGGTGGTTGCAGTGGAGATGG - Intronic
1051340664 9:16106899-16106921 GAGGGTGGCTCCAGGGTAGATGG - Intergenic
1051976733 9:22959151-22959173 GAGGGAAGCTGAAGTGCAGAGGG - Intergenic
1052348795 9:27437049-27437071 TAGGGTGGCTGAAGTCCAGCAGG + Intronic
1053025144 9:34723321-34723343 CAGGTTGTCTGGAGTGTAGCCGG + Exonic
1053189518 9:36050452-36050474 TAGGGTGGCAGCAGTGGAGATGG - Intronic
1053284139 9:36839556-36839578 GAGGGTGGGTGAAGTGTCCATGG + Exonic
1054778209 9:69141435-69141457 CAGGCTGGCTGGAGGGTACAGGG - Intronic
1056854672 9:90115950-90115972 GAGGGTGGCTGAGGTGTCCAGGG - Intergenic
1057899281 9:98935502-98935524 CAGGGTGGCTGATGTGTGATAGG + Intergenic
1058424509 9:104864738-104864760 CAGGGTGGCAGAAGTGTGGGAGG + Intronic
1059505207 9:114792491-114792513 AAGGGTGACTGAAATGAAGACGG + Intronic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1060995320 9:127872452-127872474 CAGGGTGGCTGAAGGATGGAGGG + Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061244842 9:129396236-129396258 AAGGATGGATGAAGTGTGGATGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1062404684 9:136389820-136389842 GAGGGTGGCTGGAGTGAAGCTGG + Intronic
1203427089 Un_GL000195v1:51204-51226 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1203439113 Un_GL000195v1:171861-171883 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1185609458 X:1385934-1385956 AAGGCTGGCAGAAGTGTAGCCGG - Intergenic
1186175704 X:6923909-6923931 AAGGGTGGCTGAACTGCAAAGGG - Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1187941525 X:24387329-24387351 AAGGGTGACTGCAGTGGAGAGGG + Intergenic
1189743945 X:44150665-44150687 CAGGGTGGCTGAAGCGGGCATGG + Intronic
1191210457 X:57879334-57879356 CAGTGTTGCTGAAGTTCAGATGG - Intergenic
1192244391 X:69360669-69360691 CAGGGTGGTGGCAGTGGAGATGG + Intergenic
1192551656 X:72059317-72059339 TAGGGTGGCTGCAATGTGGAAGG - Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193211478 X:78811346-78811368 CATGGTGGATGACATGTAGATGG - Intergenic
1195084363 X:101400355-101400377 CAGGGTGCATGTAGTGAAGATGG + Intronic
1196492157 X:116280710-116280732 CAGTTTGGCTGAAGTGAAAATGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196704469 X:118704892-118704914 CAGGGTGGATGAAGACTACAGGG - Intergenic
1196757779 X:119172848-119172870 CAGGGAGTCTGAAGTGTAGCAGG + Intergenic
1196778534 X:119362148-119362170 CAGGGTGGCTGCTGGGCAGAGGG - Intergenic
1197525926 X:127562709-127562731 CAGGTTTGCTGAAGAGCAGATGG + Intergenic
1197637177 X:128928290-128928312 CAGGGTGGCTGAACTATGAAAGG - Intergenic
1198463226 X:136882692-136882714 CAGGGTGGCGGCAGTGGACACGG + Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1200099984 X:153685508-153685530 CAGGGTGGCCGACGTGGGGAGGG + Intronic