ID: 1045032189

View in Genome Browser
Species Human (GRCh38)
Location 8:98147686-98147708
Sequence CAGTGTGGCTAGAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045032179_1045032189 22 Left 1045032179 8:98147641-98147663 CCTTGAAATATTCTAGGTATGAC 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG No data
1045032178_1045032189 23 Left 1045032178 8:98147640-98147662 CCCTTGAAATATTCTAGGTATGA 0: 1
1: 0
2: 3
3: 18
4: 260
Right 1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045032189 Original CRISPR CAGTGTGGCTAGAGTGGAGA GGG Intronic
No off target data available for this crispr