ID: 1045032675

View in Genome Browser
Species Human (GRCh38)
Location 8:98152660-98152682
Sequence AACAGACAGCAGGCCACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045032670_1045032675 23 Left 1045032670 8:98152614-98152636 CCATTTAAAAACGTAGAAACCAT 0: 1
1: 4
2: 78
3: 277
4: 714
Right 1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG No data
1045032673_1045032675 4 Left 1045032673 8:98152633-98152655 CCATTCTTAGCTCATGGGTCATA 0: 3
1: 21
2: 47
3: 139
4: 367
Right 1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045032675 Original CRISPR AACAGACAGCAGGCCACATT TGG Intronic
No off target data available for this crispr