ID: 1045034280

View in Genome Browser
Species Human (GRCh38)
Location 8:98165277-98165299
Sequence AATAATCACCCTGTCTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045034280_1045034283 30 Left 1045034280 8:98165277-98165299 CCTCAGAAGACAGGGTGATTATT No data
Right 1045034283 8:98165330-98165352 TGCACACTGTATACACCAGGTGG No data
1045034280_1045034282 27 Left 1045034280 8:98165277-98165299 CCTCAGAAGACAGGGTGATTATT No data
Right 1045034282 8:98165327-98165349 ATGTGCACACTGTATACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045034280 Original CRISPR AATAATCACCCTGTCTTCTG AGG (reversed) Intergenic
No off target data available for this crispr