ID: 1045034281

View in Genome Browser
Species Human (GRCh38)
Location 8:98165301-98165323
Sequence CATGCTTCACAAGTGACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045034281_1045034283 6 Left 1045034281 8:98165301-98165323 CCTGTTGTCACTTGTGAAGCATG No data
Right 1045034283 8:98165330-98165352 TGCACACTGTATACACCAGGTGG No data
1045034281_1045034282 3 Left 1045034281 8:98165301-98165323 CCTGTTGTCACTTGTGAAGCATG No data
Right 1045034282 8:98165327-98165349 ATGTGCACACTGTATACACCAGG No data
1045034281_1045034286 11 Left 1045034281 8:98165301-98165323 CCTGTTGTCACTTGTGAAGCATG No data
Right 1045034286 8:98165335-98165357 ACTGTATACACCAGGTGGAGGGG No data
1045034281_1045034287 18 Left 1045034281 8:98165301-98165323 CCTGTTGTCACTTGTGAAGCATG No data
Right 1045034287 8:98165342-98165364 ACACCAGGTGGAGGGGTGTCTGG No data
1045034281_1045034284 9 Left 1045034281 8:98165301-98165323 CCTGTTGTCACTTGTGAAGCATG No data
Right 1045034284 8:98165333-98165355 ACACTGTATACACCAGGTGGAGG No data
1045034281_1045034285 10 Left 1045034281 8:98165301-98165323 CCTGTTGTCACTTGTGAAGCATG No data
Right 1045034285 8:98165334-98165356 CACTGTATACACCAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045034281 Original CRISPR CATGCTTCACAAGTGACAAC AGG (reversed) Intergenic
No off target data available for this crispr