ID: 1045034283

View in Genome Browser
Species Human (GRCh38)
Location 8:98165330-98165352
Sequence TGCACACTGTATACACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045034281_1045034283 6 Left 1045034281 8:98165301-98165323 CCTGTTGTCACTTGTGAAGCATG No data
Right 1045034283 8:98165330-98165352 TGCACACTGTATACACCAGGTGG No data
1045034280_1045034283 30 Left 1045034280 8:98165277-98165299 CCTCAGAAGACAGGGTGATTATT No data
Right 1045034283 8:98165330-98165352 TGCACACTGTATACACCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045034283 Original CRISPR TGCACACTGTATACACCAGG TGG Intergenic
No off target data available for this crispr