ID: 1045035103

View in Genome Browser
Species Human (GRCh38)
Location 8:98170438-98170460
Sequence GCGCACATTCGCCTGGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045035094_1045035103 17 Left 1045035094 8:98170398-98170420 CCAGGGGGCTACATGACCAGGTC No data
Right 1045035103 8:98170438-98170460 GCGCACATTCGCCTGGGGGACGG No data
1045035093_1045035103 18 Left 1045035093 8:98170397-98170419 CCCAGGGGGCTACATGACCAGGT No data
Right 1045035103 8:98170438-98170460 GCGCACATTCGCCTGGGGGACGG No data
1045035096_1045035103 1 Left 1045035096 8:98170414-98170436 CCAGGTCTGTTTCTGCCTCTGGG No data
Right 1045035103 8:98170438-98170460 GCGCACATTCGCCTGGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045035103 Original CRISPR GCGCACATTCGCCTGGGGGA CGG Intergenic