ID: 1045036045

View in Genome Browser
Species Human (GRCh38)
Location 8:98177169-98177191
Sequence CAGTGCCAAGTGCTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045036045_1045036052 26 Left 1045036045 8:98177169-98177191 CCCTGCCCCAGCACTTGGCACTG No data
Right 1045036052 8:98177218-98177240 CAATATTCTTCCTAGCCCCCAGG No data
1045036045_1045036051 -10 Left 1045036045 8:98177169-98177191 CCCTGCCCCAGCACTTGGCACTG No data
Right 1045036051 8:98177182-98177204 CTTGGCACTGTCAGCATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045036045 Original CRISPR CAGTGCCAAGTGCTGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr