ID: 1045036244

View in Genome Browser
Species Human (GRCh38)
Location 8:98178570-98178592
Sequence GTGGAAAGATGGGGTTAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045036244_1045036249 -7 Left 1045036244 8:98178570-98178592 CCCGGCTAACCCCATCTTTCCAC No data
Right 1045036249 8:98178586-98178608 TTTCCACCAAGAAGCACCTCTGG No data
1045036244_1045036254 27 Left 1045036244 8:98178570-98178592 CCCGGCTAACCCCATCTTTCCAC No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036244_1045036252 -1 Left 1045036244 8:98178570-98178592 CCCGGCTAACCCCATCTTTCCAC No data
Right 1045036252 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045036244 Original CRISPR GTGGAAAGATGGGGTTAGCC GGG (reversed) Intergenic
No off target data available for this crispr