ID: 1045036246

View in Genome Browser
Species Human (GRCh38)
Location 8:98178579-98178601
Sequence TGCTTCTTGGTGGAAAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045036246_1045036254 18 Left 1045036246 8:98178579-98178601 CCCCATCTTTCCACCAAGAAGCA No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036246_1045036252 -10 Left 1045036246 8:98178579-98178601 CCCCATCTTTCCACCAAGAAGCA No data
Right 1045036252 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045036246 Original CRISPR TGCTTCTTGGTGGAAAGATG GGG (reversed) Intergenic
No off target data available for this crispr