ID: 1045036250

View in Genome Browser
Species Human (GRCh38)
Location 8:98178589-98178611
Sequence TATCCAGAGGTGCTTCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045036250_1045036260 22 Left 1045036250 8:98178589-98178611 CCACCAAGAAGCACCTCTGGATA No data
Right 1045036260 8:98178634-98178656 CCATGCAGGCACAGAAGCCAGGG No data
1045036250_1045036254 8 Left 1045036250 8:98178589-98178611 CCACCAAGAAGCACCTCTGGATA No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036250_1045036258 21 Left 1045036250 8:98178589-98178611 CCACCAAGAAGCACCTCTGGATA No data
Right 1045036258 8:98178633-98178655 CCCATGCAGGCACAGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045036250 Original CRISPR TATCCAGAGGTGCTTCTTGG TGG (reversed) Intergenic
No off target data available for this crispr