ID: 1045036252

View in Genome Browser
Species Human (GRCh38)
Location 8:98178592-98178614
Sequence CCAAGAAGCACCTCTGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045036245_1045036252 -2 Left 1045036245 8:98178571-98178593 CCGGCTAACCCCATCTTTCCACC No data
Right 1045036252 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data
1045036241_1045036252 20 Left 1045036241 8:98178549-98178571 CCCATGGACACTGCTGTGGGACC No data
Right 1045036252 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data
1045036246_1045036252 -10 Left 1045036246 8:98178579-98178601 CCCCATCTTTCCACCAAGAAGCA No data
Right 1045036252 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data
1045036244_1045036252 -1 Left 1045036244 8:98178570-98178592 CCCGGCTAACCCCATCTTTCCAC No data
Right 1045036252 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data
1045036238_1045036252 28 Left 1045036238 8:98178541-98178563 CCTCTGTGCCCATGGACACTGCT No data
Right 1045036252 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data
1045036242_1045036252 19 Left 1045036242 8:98178550-98178572 CCATGGACACTGCTGTGGGACCC No data
Right 1045036252 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045036252 Original CRISPR CCAAGAAGCACCTCTGGATA TGG Intergenic
No off target data available for this crispr