ID: 1045036254

View in Genome Browser
Species Human (GRCh38)
Location 8:98178620-98178642
Sequence ATCCACCTGTAAGCCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045036253_1045036254 -5 Left 1045036253 8:98178602-98178624 CCTCTGGATATGGCTCTTATCCA No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036246_1045036254 18 Left 1045036246 8:98178579-98178601 CCCCATCTTTCCACCAAGAAGCA No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036244_1045036254 27 Left 1045036244 8:98178570-98178592 CCCGGCTAACCCCATCTTTCCAC No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036245_1045036254 26 Left 1045036245 8:98178571-98178593 CCGGCTAACCCCATCTTTCCACC No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036248_1045036254 16 Left 1045036248 8:98178581-98178603 CCATCTTTCCACCAAGAAGCACC No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036251_1045036254 5 Left 1045036251 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036247_1045036254 17 Left 1045036247 8:98178580-98178602 CCCATCTTTCCACCAAGAAGCAC No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data
1045036250_1045036254 8 Left 1045036250 8:98178589-98178611 CCACCAAGAAGCACCTCTGGATA No data
Right 1045036254 8:98178620-98178642 ATCCACCTGTAAGCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045036254 Original CRISPR ATCCACCTGTAAGCCCATGC AGG Intergenic
No off target data available for this crispr