ID: 1045036260

View in Genome Browser
Species Human (GRCh38)
Location 8:98178634-98178656
Sequence CCATGCAGGCACAGAAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045036250_1045036260 22 Left 1045036250 8:98178589-98178611 CCACCAAGAAGCACCTCTGGATA No data
Right 1045036260 8:98178634-98178656 CCATGCAGGCACAGAAGCCAGGG No data
1045036251_1045036260 19 Left 1045036251 8:98178592-98178614 CCAAGAAGCACCTCTGGATATGG No data
Right 1045036260 8:98178634-98178656 CCATGCAGGCACAGAAGCCAGGG No data
1045036248_1045036260 30 Left 1045036248 8:98178581-98178603 CCATCTTTCCACCAAGAAGCACC No data
Right 1045036260 8:98178634-98178656 CCATGCAGGCACAGAAGCCAGGG No data
1045036253_1045036260 9 Left 1045036253 8:98178602-98178624 CCTCTGGATATGGCTCTTATCCA No data
Right 1045036260 8:98178634-98178656 CCATGCAGGCACAGAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045036260 Original CRISPR CCATGCAGGCACAGAAGCCA GGG Intergenic
No off target data available for this crispr