ID: 1045038963

View in Genome Browser
Species Human (GRCh38)
Location 8:98202565-98202587
Sequence ACATAGCAAGAGATGGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045038963_1045038971 28 Left 1045038963 8:98202565-98202587 CCTCGCCCCATCTCTTGCTATGT 0: 1
1: 0
2: 1
3: 16
4: 266
Right 1045038971 8:98202616-98202638 CCATGAGTAAAAGCTTCCTGAGG 0: 174
1: 530
2: 1074
3: 3218
4: 10932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045038963 Original CRISPR ACATAGCAAGAGATGGGGCG AGG (reversed) Intronic
900965410 1:5953882-5953904 ATATAGGAAGAGATGGAGCTAGG - Intronic
902772381 1:18652823-18652845 ACATAGCAAGAGGTGGGCAAGGG - Intronic
904164990 1:28548548-28548570 AATTAGCAAGAGGTGGGGCCGGG + Intergenic
904786572 1:32987473-32987495 ACCTTGCAAGAGATGGTGTGGGG - Intergenic
905412953 1:37784565-37784587 ACAAAGCAGGAGGTGGGGAGAGG - Intergenic
905787733 1:40771331-40771353 TCAGAGCAAGGGATGGGGAGAGG - Intronic
907374891 1:54028512-54028534 GCATAACAAAAGATGGGGCTAGG - Intergenic
907967851 1:59350566-59350588 GCATAGCAGGAGATGAGGCCAGG + Intronic
911146259 1:94555278-94555300 ATATGGCAAGAGGTGGGGCAGGG - Intergenic
911621482 1:100070723-100070745 AAATAGCAAGAAAGGGGGTGGGG - Intronic
912039077 1:105362663-105362685 ACATAGCAAGAGAGGAAGCAAGG - Intergenic
914737813 1:150435222-150435244 AGATAGAAAGAGATGGGGAATGG - Intronic
916002778 1:160632875-160632897 ACAGAGCAAGTGATGGAGCTAGG - Intronic
918811152 1:189122727-189122749 ACACAGCAAGAGGTGAGGAGTGG + Intergenic
918998074 1:191788988-191789010 ACATGGCAAGAGATGGAACATGG - Intergenic
919598259 1:199591312-199591334 ACATAGCAAGAGATTTGAAGTGG + Intergenic
920611664 1:207445335-207445357 ACATAGCAAGTGTAGGGGCATGG - Intergenic
920999096 1:211024928-211024950 ACCTAGCAAGAGATGGTGACAGG + Intronic
921195913 1:212757590-212757612 CCATGGCAAGAGATGGAGCAAGG + Intronic
922086854 1:222357452-222357474 ACACAGGAAGAGGTGGGGCCAGG - Intergenic
923313909 1:232760861-232760883 ACATAGCCAGATATGGGGGTAGG - Intergenic
923313945 1:232761093-232761115 ACATAGCCAGATATGGGGAAAGG - Intergenic
923537864 1:234866894-234866916 AAATAGCAAGAGGCTGGGCGGGG + Intergenic
923851256 1:237797565-237797587 ACTCAGCAAGAGATGGGTCCAGG - Intronic
923857975 1:237864967-237864989 AGACAGCAGGAGATGGGGAGAGG - Intergenic
1062918001 10:1256601-1256623 ATATATCAAAAGATGGGGCCAGG + Intronic
1063090849 10:2865239-2865261 ACACAGCAGGAGGTGGGGCTGGG - Intergenic
1063656774 10:7998555-7998577 ACATAGGGAGAGGTGGGGCATGG + Intronic
1064290844 10:14032737-14032759 TCCTAGCAACAGATGGGGTGAGG - Intronic
1065434857 10:25695401-25695423 ACAAAGGAAGAGATGGTGAGAGG - Intergenic
1065845541 10:29739714-29739736 CCATAGCCAGAGATGGGCCACGG - Intergenic
1068153244 10:53161988-53162010 ACATAGCTGGAGATGGGACAAGG + Intergenic
1068594522 10:58888341-58888363 ACATAGTAAGAGAAGTGGTGAGG - Intergenic
1069859330 10:71460746-71460768 ACAGGGCAAGAGACGGGGCTGGG - Intronic
1070420894 10:76236108-76236130 ACATAGCAAGGGAGGGGCAGAGG + Intronic
1072200879 10:93157795-93157817 ACATGGCAAGAGAAGGAGCAAGG - Intergenic
1075139769 10:119821731-119821753 ACAGAGCAAGAGACGGAGGGAGG - Intronic
1077201599 11:1310072-1310094 ACAGGGCTAAAGATGGGGCGCGG + Intergenic
1078363276 11:10686690-10686712 AGATGGAAAGAGATGGGGCTTGG + Intronic
1078565523 11:12410747-12410769 CCATAGCTATAGATGGGGTGGGG - Intronic
1078657288 11:13253547-13253569 AAATAGAAAGTGATGGGGTGGGG - Intergenic
1080107829 11:28529595-28529617 ACATAGCAGGGGGTGGGGGGCGG + Intergenic
1080157645 11:29130720-29130742 AAGTAGCAAGAGATGAGGCTGGG + Intergenic
1080624219 11:34013995-34014017 ACACAGCAAGAGACAGGGCTAGG + Intergenic
1082142902 11:48630627-48630649 AAATTGCAAGAGATGAGGCTTGG - Intergenic
1082850573 11:57760947-57760969 AAATAGCTCTAGATGGGGCGTGG + Intronic
1085949185 11:81308685-81308707 ACTTAGGAATAGATTGGGCGTGG - Intergenic
1086190416 11:84072246-84072268 ATATAGCAAGAGACAGGGCTGGG - Intronic
1087808294 11:102580425-102580447 ACATTTCAAGAGATGGTGGGTGG - Intronic
1088566537 11:111178552-111178574 AGACAGCAAGAGAGGGGGCGGGG - Intergenic
1090858845 11:130635097-130635119 ACATAGCAAGGGACGAGGCAGGG - Intergenic
1094452530 12:30597776-30597798 ACATAGCAAGAGGGGGAGCAAGG + Intergenic
1095354720 12:41258047-41258069 ACATAGCAAGTGATAGGGGCTGG + Intronic
1095772780 12:45980520-45980542 ACCTAGCAAGTGATGGAGCTGGG + Intronic
1095977510 12:47949781-47949803 GCATGCCACGAGATGGGGCGTGG + Intergenic
1096585054 12:52614546-52614568 ACAGAGCCAGAGGTGGGGCAGGG + Intronic
1097068601 12:56338640-56338662 AAATAGCTATAGAAGGGGCGGGG - Intronic
1098805432 12:75016048-75016070 ACATAGGAAGAGGTGGGGCCAGG + Intergenic
1100028841 12:90161863-90161885 AGATGGCAAGAGATGAGGCTTGG - Intergenic
1101145873 12:101839885-101839907 ATATGGAAAGAGTTGGGGCGGGG + Intergenic
1103550531 12:121733831-121733853 ACATAACAATATATGGGGCCAGG - Intronic
1103931729 12:124454173-124454195 ACACAGCAAGAGATGAGGCGTGG - Intronic
1105580091 13:21687645-21687667 ACATAGGAAGAAGTGGGGCAGGG - Intronic
1105949023 13:25213055-25213077 ACATGGCAAGGGAGGGGGTGAGG - Intergenic
1106902575 13:34369418-34369440 GCATAGTAAGTGATGGGGAGAGG + Intergenic
1108739380 13:53319890-53319912 CAATAGCAAGAGATAGGGCGGGG + Intergenic
1108770375 13:53693504-53693526 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1109785205 13:67164859-67164881 ACATAGCAAGTGATTGGGTAGGG - Intronic
1112423087 13:99271448-99271470 AGATAGCAGGAGATGAGGCCAGG + Intronic
1112432048 13:99358815-99358837 ACACAGCAAGAGATATGGGGTGG + Intronic
1112656845 13:101460778-101460800 ACATGGCAAGAGATAGAGGGAGG + Intronic
1113913954 13:113860161-113860183 ACAAAGAAAGAGATGGGGGAAGG + Intronic
1113968949 13:114173821-114173843 ACACAGAAAGTGATGGGGTGTGG - Intergenic
1114125806 14:19723921-19723943 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1119223477 14:72927079-72927101 AACTAGCAAGTGATGGGGCCTGG + Intronic
1122520139 14:102337796-102337818 ACAGAGCATGAGATGGGGGTGGG - Intronic
1122938992 14:104972880-104972902 ACACAGCAAGGGATGGGGTCAGG + Intronic
1124290234 15:28446024-28446046 ACAAAACAAGAAATGGGGAGGGG - Intergenic
1127795191 15:62431939-62431961 CCAGAGCAAGAGATGGGCCTGGG - Intronic
1128568513 15:68716829-68716851 ATGTAGCAGGAGATGGGGGGAGG + Intronic
1128846375 15:70900365-70900387 ACAAAGAAAGAGATGATGCGAGG + Intronic
1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG + Intronic
1131694683 15:94863800-94863822 AGAGAGCTAGAGGTGGGGCGGGG + Intergenic
1134874844 16:17688814-17688836 ACATAGCAAGGGAGGGAGCAAGG + Intergenic
1136627283 16:31469568-31469590 ACAGTGCAAGAGAGGGGGTGGGG - Intergenic
1136708503 16:32211596-32211618 ACAAAACAAGAAATGGGGAGGGG + Intergenic
1136759401 16:32717816-32717838 ACAAAACAAGAAATGGGGAGGGG - Intergenic
1136808703 16:33152570-33152592 ACAAAACAAGAAATGGGGAGGGG + Intergenic
1137038940 16:35591952-35591974 CCATCCCAAGAGATGGGGAGAGG - Intergenic
1137875418 16:51992195-51992217 AGATAGCAAGGGATGGGGGCTGG + Intergenic
1138659872 16:58510610-58510632 ACAGAGCCGGAGAGGGGGCGGGG - Intronic
1141125255 16:81396589-81396611 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1141140796 16:81495638-81495660 ACATAAAAAGAGAAGGGGCCTGG - Intronic
1141303896 16:82843011-82843033 ACATAGCAAGAGGTGAGTGGCGG - Intronic
1141953057 16:87351567-87351589 AAATAGCAAGGGATAGGGCTGGG + Intronic
1141997168 16:87642835-87642857 ACAGAGCAAGACATGGGCCCAGG + Intronic
1142165581 16:88585773-88585795 AGATTGCAGGAGATGGGGAGGGG + Intronic
1203061557 16_KI270728v1_random:978125-978147 ACAAAACAAGAAATGGGGAGGGG - Intergenic
1142814583 17:2415196-2415218 ACATAGGAGGAGAAGGGGCCAGG - Intronic
1144479563 17:15617674-15617696 AAGTAGCAAGAGAAGGGGAGGGG - Intronic
1144603712 17:16644058-16644080 ACATAGCAAGAGAGGGAGAGGGG - Intronic
1144918739 17:18746065-18746087 AAGTAGCAAGAGAAGGGGAGGGG + Intronic
1146296274 17:31653144-31653166 ACATGGCAAGAGAAAGGGCAAGG + Intergenic
1147951116 17:44108607-44108629 ACCGATCAAGAGATGGGGAGAGG + Intronic
1148196184 17:45715080-45715102 ACATAGCCAGAGCAGGGGCAAGG + Intergenic
1148395860 17:47307633-47307655 ACACAGTAAGAGACGGGGCTGGG + Exonic
1148438359 17:47699029-47699051 TCACAGCCAGAGACGGGGCGGGG - Intronic
1150700379 17:67442129-67442151 ACATAGCAATAAATGAGGAGAGG - Intronic
1151420934 17:73997075-73997097 ACACACCAGGAGATGGGGTGAGG + Intergenic
1156036697 18:32772441-32772463 GAATAGGAAAAGATGGGGCGGGG - Intronic
1156835994 18:41555726-41555748 ACCTTGCAAGAGATGGTGAGGGG - Intergenic
1157710514 18:49846947-49846969 ACACAGCAGGAGCTGGGGGGAGG + Intronic
1159134906 18:64326350-64326372 ACACAGGAAGAGAAGGGGCCAGG + Intergenic
1160625666 18:80202935-80202957 ACAATGCAAGAGACGGGGTGGGG + Intronic
1163011319 19:14428302-14428324 ACAAACCAAGAAAGGGGGCGGGG - Intergenic
1165163518 19:33832955-33832977 ACATCGACAGAGATGGGGCAGGG + Intergenic
1165858148 19:38892501-38892523 ACATAGCGAGAGCTGTGGCAGGG - Intronic
1166310924 19:41962225-41962247 CCATGGCAAGAGACGGGGAGGGG + Intergenic
1168207835 19:54865359-54865381 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1168535524 19:57166093-57166115 ACATTGCAGGAGGTGGGGAGAGG + Intronic
925212571 2:2062483-2062505 AGATTACAAGAGATGGGGCAGGG - Intronic
926350666 2:11991291-11991313 ACATGGCAAGAGCAGGGGCAAGG - Intergenic
926652616 2:15362925-15362947 AGAAAGAAAGAGATGGGGCCAGG + Intronic
927508120 2:23627669-23627691 ACCTAACAAGAGAGGGGACGCGG - Intronic
927856845 2:26533036-26533058 ACACAGCAAGAGGTGAGCCGCGG + Intronic
929118509 2:38464988-38465010 ACATAGGAAGAGAGGAAGCGGGG - Intergenic
929992647 2:46802760-46802782 ACATAGAAAGACATTGGCCGAGG + Intergenic
932079282 2:68696792-68696814 AAATAGAAAGGGAAGGGGCGTGG + Intronic
932236234 2:70123423-70123445 AGGGAGCAAGAGATGGGGCGTGG + Intergenic
933130804 2:78672636-78672658 ACACAGGAAGAGAAGGGGCCAGG + Intergenic
933131454 2:78677933-78677955 ACACAGGAAGAGAAGGGGCCAGG + Intergenic
933938488 2:87226084-87226106 ACATAGGAAGAGAAGGGGAAGGG - Intergenic
934204058 2:89910659-89910681 GCAGAGCAGGAGCTGGGGCGAGG - Intergenic
937727849 2:125187938-125187960 ACACAGGAAGAGAAGGGGCCAGG + Intergenic
940374860 2:152946342-152946364 ACATGGCAAGAGAGGGAGTGAGG - Intergenic
942549837 2:177103941-177103963 ACAATGCAAGCGATGGGACGTGG + Intergenic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
942599804 2:177629205-177629227 ACAAAGAAAGAGGTGGGGCAGGG - Exonic
942769541 2:179500560-179500582 ATATGGCAAGAGATGGGGTCTGG - Intronic
943000960 2:182328381-182328403 ACATAGAAAGAAATGGAACGAGG + Intronic
943406985 2:187501302-187501324 ACATCCCAGGACATGGGGCGGGG - Intronic
945149901 2:206779527-206779549 AGAGAGCAAGAGAAAGGGCGAGG + Intronic
945342222 2:208669924-208669946 ACAAAGTCAGAGATGGGGCATGG - Intronic
945975152 2:216264618-216264640 ACAGTGGAAGAGATGGGGTGTGG + Intronic
948022375 2:234745554-234745576 ACATAGCAATATATGGTGCCAGG + Intergenic
1169621278 20:7509134-7509156 ACATGGCAGGAGATGGAGCAGGG + Intergenic
1173040768 20:39460258-39460280 AGAGAGAAAGAGATGGGGCATGG + Intergenic
1173364994 20:42377013-42377035 ACATAGAAAGAGAGGGAGCAAGG + Intronic
1174079742 20:47962467-47962489 ACATAGCCAGAGGCGGGGCCAGG - Intergenic
1176119258 20:63446623-63446645 ACATGGCCAGAGCTGGGGCTGGG + Intronic
1176180796 20:63748442-63748464 ACATGGCCAGGGATGGGGAGAGG + Intronic
1176996198 21:15558169-15558191 ACATAGCGAGGGGTGGGGCCAGG - Intergenic
1177344588 21:19853553-19853575 ACATGGCAAGAGGTGGGGAGAGG + Intergenic
1178088799 21:29139878-29139900 AAAAAGCCAGAGATGGGGCCTGG - Intronic
1179418782 21:41219394-41219416 ACATAGGAAGAGATAGGATGAGG + Intronic
1179769907 21:43606698-43606720 AGATAGCAGGAAATGGGGAGGGG + Intronic
1179807854 21:43851435-43851457 ACATGGAAAGAGATGGGGACAGG + Intergenic
1181858804 22:25802252-25802274 ACAGGGCAAGGGATGGGGAGAGG + Intronic
1183245826 22:36692661-36692683 ACAAATAAAGAGATGGGGCCTGG - Intronic
1183798243 22:40138705-40138727 ATATAGGAATAGATGGGGCTGGG + Intronic
1183888336 22:40903852-40903874 ACAGAGAGAGAGATGGGGGGAGG - Intronic
949289277 3:2444977-2444999 ACATAGTAAGAAGTGGGGTGGGG - Intronic
949964102 3:9340707-9340729 ACACATCAAGAAATGGGGCTGGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
953553789 3:43925745-43925767 ACATAGGAAGATATTGGGGGAGG - Intergenic
953693404 3:45139013-45139035 ACATAGCAAGAGAAGAAGCAAGG + Intronic
956380633 3:68661093-68661115 ACATAGCAGGAGATGAGGGGTGG - Intergenic
956742992 3:72289504-72289526 ATATTGCAGGAGATGGGGGGTGG + Intergenic
959761392 3:109969800-109969822 AATAAGCAAGAGATGGGGCCAGG - Intergenic
961015875 3:123467866-123467888 ACAAAACTAGAGATGGGGCCTGG + Intergenic
962199752 3:133391578-133391600 GCTTAGCAAAAGATGGGGAGAGG - Intronic
962433819 3:135346451-135346473 ACATGGCAAGAGAAGATGCGAGG - Intergenic
963867561 3:150379026-150379048 CAGGAGCAAGAGATGGGGCGGGG - Intergenic
964453484 3:156835836-156835858 ACAGAGCAAGACTTGGGGGGAGG - Intronic
965582029 3:170278826-170278848 ACATGGCAAGAGAGGGAGCAAGG + Intronic
965848133 3:172988520-172988542 ACTTTCCAAGAGATGGGGAGAGG + Intronic
968072347 3:195793200-195793222 AAATAATAAGAGATGGGGCCGGG + Intronic
968283867 3:197496828-197496850 ACACTGTAAGAGATGGGGGGAGG - Intergenic
969550218 4:7860992-7861014 ACTAAGCAACAGATGGGGCAGGG - Intronic
971148130 4:24001958-24001980 ACATACCAAGAAATGGGGGAAGG + Intergenic
972191405 4:36596112-36596134 ACATATCATGAAATGGGGCAGGG + Intergenic
972341672 4:38157484-38157506 ACATAGCAAGAGAGGAAGCAAGG + Intergenic
974675287 4:65080147-65080169 ACATAGAAAGAGGAGGGGCCAGG - Intergenic
974729705 4:65846336-65846358 AAATGGCAAGAGATGAGGCTGGG + Intergenic
976479570 4:85524609-85524631 ACACAGCAAGAGATGGAGTTAGG + Intronic
978645323 4:110924038-110924060 ACATAGCAGCACTTGGGGCGGGG + Intergenic
979517169 4:121623052-121623074 ACATGGCAAGAGATGAAGCTGGG - Intergenic
979752167 4:124291981-124292003 ACATGGCAAGAGAGGGAGCGGGG - Intergenic
981234957 4:142405094-142405116 TCAAATCCAGAGATGGGGCGGGG + Intronic
982077276 4:151750254-151750276 ACCTAGGAAGGGGTGGGGCGGGG - Intronic
982746407 4:159107580-159107602 AAATAGGAGGAGATGGGGTGGGG - Intronic
986395075 5:7321424-7321446 ACATGGTAAGAGATGGAGCTTGG + Intergenic
986631610 5:9779209-9779231 ACATGACAAGAGATGGAGCAAGG - Intergenic
986797434 5:11225711-11225733 ACCTAGCAAGTGAGGTGGCGAGG - Intronic
986995100 5:13597817-13597839 AAAAAGCAAAAGATGGGGTGTGG - Intergenic
987603872 5:20107912-20107934 ACACAGCAAGAAAGGGGGAGGGG - Intronic
987859895 5:23471160-23471182 ACATAGCAAGAGATGGAGAAAGG + Intergenic
990996867 5:61741079-61741101 ACATAGCAAGAGAATGGTAGTGG + Intronic
991188431 5:63838954-63838976 ACATAGCAAGAGATGCAGCAAGG + Intergenic
991317613 5:65327144-65327166 ACATGGCAAGAGAGGGAGCAAGG - Intronic
991479043 5:67057216-67057238 ACATAGCAACAGAAAGGGTGAGG - Intronic
993391384 5:87322536-87322558 AGAGAGCAAGAGAAGGGGGGAGG - Intronic
995561676 5:113388585-113388607 ACATAGCAAGAGAGGGAGCAAGG - Intronic
995913176 5:117212406-117212428 ACATGGCAAGAGAAGAGGCAAGG + Intergenic
996817889 5:127593995-127594017 CCATAGCAAGACATGGAGTGAGG - Intergenic
997526179 5:134554730-134554752 AGATAGCAACAGAAGAGGCGTGG - Intronic
997899076 5:137747166-137747188 ACTTAGCAAGAGATTGTGAGTGG - Intergenic
1000643628 5:163735232-163735254 ACACAGGAAGAGGTGGGGCCAGG + Intergenic
1002277804 5:178114575-178114597 ACATAGGAACAGATTGGGCCTGG + Intronic
1002474486 5:179456245-179456267 ACACAGGAAGAGGCGGGGCGAGG + Intergenic
1002806103 6:575521-575543 GCATGGCAGGAGATGGAGCGAGG - Intronic
1003323608 6:5075044-5075066 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1003938286 6:10998090-10998112 ACATGGCAAGAGAGGGAGCAAGG - Intronic
1004313157 6:14563737-14563759 ACAGAGGAATAGATGGGGCATGG - Intergenic
1008720506 6:54344370-54344392 AGATAGCCAGAGAGGGGGTGTGG - Intronic
1010085535 6:71913493-71913515 ATAGACAAAGAGATGGGGCGGGG - Intronic
1010231444 6:73538840-73538862 AGATATCAAGAGGCGGGGCGTGG + Intergenic
1011078230 6:83461010-83461032 ACATGGCAAGAGAAGGAGTGAGG - Intergenic
1011725841 6:90209773-90209795 ACATAAGAACAGTTGGGGCGGGG - Intronic
1016700374 6:147047698-147047720 ACATAGCGAGAGCTGGAGCAAGG - Intergenic
1017154761 6:151312859-151312881 CCATGGCAGGAGATGGGGTGAGG + Intronic
1018002179 6:159589130-159589152 ACAAAGGTAGAGATGGGGAGAGG - Intergenic
1018029441 6:159830476-159830498 CAATAGCAAGAGCTGGGGCAGGG - Intergenic
1018554148 6:165033325-165033347 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1022228887 7:28393701-28393723 ACATTGTAAGAGATGAGGGGAGG + Intronic
1022315494 7:29241385-29241407 ACATAGAAAGAGTGGGGGCCAGG + Intronic
1022424766 7:30257771-30257793 TGATAGCGAGAGATGTGGCGGGG - Intergenic
1022945195 7:35276978-35277000 AGCTAGCAAGAGAGGGAGCGAGG - Intergenic
1022956498 7:35386206-35386228 ACATAGCAAATGATGAGGCTTGG - Intergenic
1024302434 7:47897429-47897451 ACATAGAAAGGGATTGGGAGGGG - Intronic
1025825359 7:65006500-65006522 ACATCCCGAGAGAGGGGGCGGGG - Intronic
1028216521 7:88140066-88140088 ACATGGCAAGAGAGGGAGCAGGG + Intronic
1028316016 7:89404258-89404280 ACACAGCAAGAGATGAGGGGTGG - Intergenic
1028831075 7:95327149-95327171 ACATGGCAAGAGAGGGAGTGGGG - Intergenic
1029046921 7:97639716-97639738 ACACAGGAAGAGAAGGGGCCAGG + Intergenic
1029352984 7:100028633-100028655 ACTTGGCAAGAGATGGGGAGGGG + Intronic
1029898874 7:104019108-104019130 AGATAGAAAGATATGGGGCCTGG - Intergenic
1030085221 7:105810172-105810194 AGATGGCAAAAGATGGGGCAGGG + Intronic
1033330440 7:140412833-140412855 ACATAAACATAGATGGGGCGTGG + Intronic
1033941521 7:146660904-146660926 CCATAGCAAGAAGTGAGGCGGGG + Intronic
1034432942 7:151050025-151050047 ACATACCATGAGGTGGGGAGAGG + Intronic
1036717788 8:11142606-11142628 ACATGGCAAGAGCTGGAGCAAGG - Intronic
1037946964 8:22995783-22995805 ACATGGCAGGGGATGGGGGGCGG + Intronic
1038015930 8:23514936-23514958 ACACAGCAAGAGATGGATCTTGG - Intergenic
1038628456 8:29217378-29217400 ACATAGTAAGTGGTGGGGCTGGG - Intronic
1040001377 8:42579366-42579388 ACAGAGCAAGAGCTGGGAAGGGG - Intergenic
1043145413 8:76647943-76647965 ACAAGGCAAGAGATGAGGCTTGG + Intergenic
1043159685 8:76830076-76830098 CCATAGCAAGTGATGGAGCTGGG - Intronic
1045038963 8:98202565-98202587 ACATAGCAAGAGATGGGGCGAGG - Intronic
1045598485 8:103685313-103685335 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1046839110 8:118837938-118837960 ACAGAGCAAGGTATGGGGCGAGG + Intergenic
1047398538 8:124526168-124526190 ACAAATCAAAAGGTGGGGCGCGG - Intronic
1047978531 8:130155949-130155971 ACATAGCTAGAGATCGCGCTGGG - Intronic
1049626048 8:143621961-143621983 ACATAGCAGGAGGTGAGGCCAGG - Intergenic
1049960325 9:732034-732056 AAATAGGAAGACATGGGGTGGGG + Intronic
1050630686 9:7555484-7555506 ACAGAGCAAGACTCGGGGCGGGG - Intergenic
1050758161 9:9033673-9033695 ACAGAGAAAGAGAAGGGGAGGGG - Intronic
1053269280 9:36739313-36739335 AAAAGGCAAGAGTTGGGGCGGGG - Intergenic
1053852010 9:42298828-42298850 ACACAGGAAGAGGTGGGGCCAGG - Intergenic
1054961966 9:70979243-70979265 ACCTGGCCAGACATGGGGCGCGG + Intronic
1056041333 9:82670396-82670418 ACATAGCAAGAGAAAGGACAGGG + Intergenic
1056451772 9:86723501-86723523 AGGAAGCAAGAGATGGGGGGTGG - Intergenic
1056601395 9:88049956-88049978 ACACAGCCATAGATGGGGTGGGG - Intergenic
1058862895 9:109134539-109134561 ACATAGCAAGTGAGGAGGAGTGG + Exonic
1059256309 9:112934477-112934499 ATATAGCAGGGGATGGGGAGTGG - Intergenic
1059771248 9:117428459-117428481 ACATAGCTAGTGATGGGGCCAGG + Intergenic
1059853447 9:118368737-118368759 AGAGAGGAAGAGATGGGGAGAGG + Intergenic
1061152397 9:128836281-128836303 ACAAAGAAAGAAATGGGGGGTGG - Intronic
1185604448 X:1359844-1359866 ACAGAGAAAGAGATGGGGAGGGG - Intronic
1185982306 X:4793234-4793256 ACAGGGCATGAGATGGGGTGTGG - Intergenic
1187158187 X:16740629-16740651 ACACAGCAAGAGCTGGAGAGAGG - Intronic
1187269925 X:17770448-17770470 ACACAGTAAGAGATGGGCAGAGG - Intergenic
1189042106 X:37553659-37553681 ACACAGGAAGAGGTGGGGCCAGG + Intronic
1189654352 X:43226439-43226461 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1191122610 X:56921828-56921850 AGATGGCAAGAGATGAGGCTTGG + Intergenic
1194600824 X:95919538-95919560 ACATAGAAAGAGAAGAGGCTGGG - Intergenic
1195933981 X:110107675-110107697 ACAGAGCAAGACTTGGGGAGGGG - Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1197291766 X:124667051-124667073 ACATAGAAAGAGCTGGGACTAGG - Intronic
1197730469 X:129805224-129805246 CCATAGCCAGAGGTGGGCCGAGG + Exonic
1198133502 X:133723678-133723700 ACATAGCAAGGGAGGGAGCAAGG - Intronic
1198570673 X:137952435-137952457 ATATGGCAAGAGATGGGGGCAGG + Intergenic
1199654593 X:149981749-149981771 ACAGAGGAAGAGGTGGGGTGTGG - Intergenic
1201426851 Y:13860580-13860602 ACATAGCAGGAGATGAGTGGTGG - Intergenic