ID: 1045039868

View in Genome Browser
Species Human (GRCh38)
Location 8:98213201-98213223
Sequence CTGGGGAGGTTGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1929
Summary {0: 1, 1: 0, 2: 17, 3: 210, 4: 1701}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045039868_1045039879 24 Left 1045039868 8:98213201-98213223 CCCTCCTCCTTCAACCTCCCCAG 0: 1
1: 0
2: 17
3: 210
4: 1701
Right 1045039879 8:98213248-98213270 TTTATCATTCACTTTCTTTATGG No data
1045039868_1045039874 -9 Left 1045039868 8:98213201-98213223 CCCTCCTCCTTCAACCTCCCCAG 0: 1
1: 0
2: 17
3: 210
4: 1701
Right 1045039874 8:98213215-98213237 CCTCCCCAGGAACCACTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045039868 Original CRISPR CTGGGGAGGTTGAAGGAGGA GGG (reversed) Intronic
900159255 1:1215777-1215799 CTGGGCAGCTTCAAGCAGGAGGG - Intergenic
900712406 1:4122660-4122682 CTGGGGAGGCGGGAGAAGGAGGG + Intergenic
901160542 1:7173757-7173779 GTTGGGAGGTGCAAGGAGGAAGG + Intronic
901399363 1:9005511-9005533 GTGGGAAGCTTGGAGGAGGAGGG - Intronic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901545595 1:9954315-9954337 CTTGGGAGGTTGAAGTAAGAGGG - Intronic
901547411 1:9968829-9968851 CTTGGGAGGCTGAAGCAGGGAGG + Intronic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
901703404 1:11057399-11057421 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
902315549 1:15616205-15616227 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
902430962 1:16362733-16362755 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902648984 1:17824140-17824162 ATGGTGAGGTTGGAGGAGGCTGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903073287 1:20740013-20740035 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
903209162 1:21806584-21806606 CTTGGGAGGCTGCAGCAGGAAGG - Intergenic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903279637 1:22243333-22243355 CTTGGGAGGTTGAGGTGGGATGG + Intergenic
903428629 1:23274155-23274177 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
903432356 1:23316195-23316217 CCCGGGAGGCTGAAGCAGGAGGG + Intronic
903433899 1:23331724-23331746 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903547545 1:24136060-24136082 CTCAGGAGGTTGAAGTGGGAGGG - Intronic
903578401 1:24353371-24353393 GTGGGCAGGTGGATGGAGGATGG + Intronic
903602521 1:24553252-24553274 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
903626881 1:24737052-24737074 CTAGTGAGGCTGAAGCAGGAGGG - Intergenic
903639867 1:24851487-24851509 CTCGGGAGGGTGAAGGGGGGAGG - Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903998475 1:27323045-27323067 CTGTCAAGGTTGAAGCAGGAGGG - Intronic
904193392 1:28765107-28765129 CTGGGGAGGCTGAAGGCAGGAGG - Intronic
904264168 1:29308457-29308479 CTAGGGAGGCTGAAGTGGGAGGG + Intronic
904401844 1:30262091-30262113 CTGGGGAGGGGGAACAAGGAGGG - Intergenic
904519866 1:31086537-31086559 CTGGGGAGGCTGAGACAGGAAGG + Intergenic
904707748 1:32404296-32404318 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
904716152 1:32469086-32469108 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905178932 1:36155227-36155249 CTGGGAAGGTGGATGGATGATGG - Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905436288 1:37957572-37957594 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
905699079 1:39998505-39998527 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
905878057 1:41445979-41446001 TTGGGGATCTTGAAGGGGGAAGG - Intergenic
906331790 1:44891367-44891389 TTTGGGAGGCTGAAGCAGGAAGG - Intronic
906375759 1:45295379-45295401 CTTGGGAGGCTGATGCAGGAGGG - Intronic
906394126 1:45445685-45445707 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906618592 1:47254636-47254658 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
906751252 1:48263933-48263955 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
907087828 1:51693262-51693284 CTTAGGAGGCTGAAGCAGGAGGG + Intronic
907155010 1:52325410-52325432 CTTGGGAGGTTGAGGTGGGAGGG + Intronic
907213415 1:52842603-52842625 CTGGGGAGGCGGGAGGAGAACGG + Intronic
907298708 1:53471784-53471806 CTCCGGAGGCTGAAGCAGGAGGG - Intergenic
907468472 1:54655476-54655498 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
907794179 1:57698192-57698214 CTTGAGAGGGTGAAGAAGGAGGG - Intronic
907882691 1:58565874-58565896 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
908320471 1:62973370-62973392 TTTGGGAGGTTGAGGCAGGAGGG - Intergenic
908343213 1:63204172-63204194 CTCGGGAGGCTGAAGTGGGAGGG - Intergenic
908389108 1:63669469-63669491 CTGGGGGCATTGAAGGAGGGCGG - Intergenic
908413952 1:63894203-63894225 CTGGGCAGGATGGAGCAGGATGG + Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908606937 1:65808277-65808299 CTTGGGAGGTTGAGGCAGGAGGG - Intronic
908817554 1:68049980-68050002 CTGGGAAGGTGGAAGGAGTGTGG - Intronic
908872244 1:68626731-68626753 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
908876012 1:68676670-68676692 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909636662 1:77824316-77824338 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
909838267 1:80285432-80285454 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
909922050 1:81394360-81394382 CTGGGAAGGGTACAGGAGGAGGG - Intronic
910260365 1:85288284-85288306 CTTGGGAGGCTGAAGCAGGAAGG + Intergenic
910275514 1:85445289-85445311 GTGGGGTGCTTCAAGGAGGAGGG + Intronic
910503393 1:87921103-87921125 GTGAGGAGTTTGAAGAAGGATGG - Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910891857 1:92027085-92027107 CTTGGGAGGCTGAGGAAGGATGG + Intergenic
911101513 1:94099315-94099337 CTCTGGAGGCTGAAGGAGGCAGG + Intronic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
911633795 1:100211877-100211899 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
911702134 1:100966118-100966140 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
911729678 1:101279828-101279850 CTCGGGGGGCTGAAAGAGGAAGG + Intergenic
912377779 1:109226098-109226120 CTAGGGAGGCTGAGGCAGGAGGG - Intronic
912558740 1:110535161-110535183 CTAGGGAGGTCGAAGGAGCAGGG - Intergenic
912803282 1:112735242-112735264 CTTGGGAGGCTGAGTGAGGAAGG + Intergenic
912863894 1:113239614-113239636 CTGGGCGGCTTGAAGGAGCAAGG - Intergenic
912928453 1:113933757-113933779 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913063147 1:115226099-115226121 CTGGGGAGGTGGAACAAGCAGGG + Intergenic
913079193 1:115366007-115366029 CTGGAGAGGTTATAGCAGGATGG - Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913287698 1:117241691-117241713 CTCAGGAGGTGGGAGGAGGAGGG - Intergenic
914238967 1:145838573-145838595 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
914462866 1:147900940-147900962 GGGGGCAGTTTGAAGGAGGATGG - Intergenic
914693943 1:150058399-150058421 CTCAGGAGGCTGAGGGAGGAGGG + Intergenic
914802289 1:150970601-150970623 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
915199519 1:154216620-154216642 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915305828 1:154977486-154977508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915324001 1:155071196-155071218 CTGGGGAGGTTGGTGGGGGGCGG + Intergenic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915655126 1:157353027-157353049 CTTGGGGGATTGAGGGAGGAGGG - Intergenic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
916340968 1:163734628-163734650 CTAGGGAGGCTGAGGTAGGAGGG - Intergenic
916456708 1:164978426-164978448 CTGGGAAGGGTGTAGGAGAAGGG - Intergenic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
916820910 1:168397833-168397855 CTGCGCTGCTTGAAGGAGGAAGG + Intergenic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917087576 1:171319196-171319218 CTGGGGAGCTGGAAAGGGGATGG + Intronic
917167333 1:172127238-172127260 CCGGGGAGGTTGAGAGAGTAAGG - Intronic
917565549 1:176208383-176208405 CTGGGGAGGTTGAGGCTGTAGGG + Intergenic
917945849 1:179969708-179969730 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
918006828 1:180549014-180549036 CTTGGGAGATTGGGGGAGGAGGG - Intergenic
918049333 1:180960544-180960566 CTGGGGAGGATCATGGCGGAGGG + Intergenic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918181044 1:182086297-182086319 TTGGGGAGGCTGCAGGAAGAAGG - Intergenic
918431453 1:184465011-184465033 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918851209 1:189693002-189693024 CTGGTGCTGGTGAAGGAGGAAGG - Intergenic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
919172233 1:193969309-193969331 CTTGGGAGGCTCAGGGAGGATGG + Intergenic
919323591 1:196076071-196076093 TTTGGGAGGTTGAGGCAGGAGGG - Intergenic
919573857 1:199281998-199282020 CTGGGGAGGTTGAGGCTGCAGGG + Intergenic
919733395 1:200928840-200928862 GTGGGGAGGTTGGAGAGGGATGG + Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919890729 1:201972268-201972290 TTTGGGAGGCTGAAGCAGGAAGG + Intergenic
920012846 1:202882135-202882157 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920105993 1:203554010-203554032 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
920143589 1:203839282-203839304 CTTGGGAGGCTGAAGAAGGATGG - Intronic
920188910 1:204179791-204179813 CAGGGGAGGTCGAGGGTGGAGGG + Intergenic
920221166 1:204402513-204402535 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
921056073 1:211543461-211543483 CTGGGGAGGTTGAAGTGGGAGGG - Intergenic
921086093 1:211794407-211794429 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
921935101 1:220788390-220788412 CTGGGGAGCTGGTAGGAGAAAGG - Intronic
921978375 1:221227650-221227672 CTGGGCAGGTTGGTGGCGGAAGG + Intergenic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922223220 1:223624604-223624626 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
922224231 1:223631427-223631449 CTGGGGAGGTGTGAGGAGGAAGG - Intronic
922281064 1:224124833-224124855 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
922557487 1:226543604-226543626 CTTGGGAGGTTGAAGTGAGAGGG - Intergenic
922707860 1:227799441-227799463 TTGGGGAGGTTGAAGGGCAATGG - Intergenic
922918494 1:229278700-229278722 CAGAGGTGGTTAAAGGAGGAAGG - Intronic
923026916 1:230211663-230211685 CTTGGGAGGCTGAAAGGGGAGGG + Intronic
923122915 1:231010132-231010154 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
923207625 1:231774144-231774166 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
924120259 1:240790154-240790176 CTGGGGAGGTGGAAGTTGCAGGG + Intronic
924245317 1:242078337-242078359 CTTGGGAGGCTGGAGCAGGAGGG - Intergenic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924306329 1:242692720-242692742 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
924373747 1:243384698-243384720 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924539905 1:244970774-244970796 CGAGGGAGGGGGAAGGAGGACGG - Exonic
924614363 1:245600438-245600460 CTTGGGAGGTTGAGGTAGCAGGG - Intronic
924712276 1:246539509-246539531 CTTGGAAGGTTGAGGCAGGAGGG - Intergenic
924872053 1:248058372-248058394 CTGGGGGTGATGACGGAGGAGGG - Intronic
1063017952 10:2096790-2096812 CTGGAGGGGTTGGAGGAGGCTGG - Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063425045 10:5944138-5944160 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1063481906 10:6383671-6383693 CTTGGGAGGCTGATGGGGGAGGG + Intergenic
1063523401 10:6761120-6761142 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1063816002 10:9772620-9772642 CTGAGGAGGCTGAAGCAGCAGGG - Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1064193907 10:13230198-13230220 CTAGGGAGTCTGAAGCAGGAGGG + Intronic
1064203377 10:13302421-13302443 CTGGGGCGGGTGCAGGTGGAGGG + Intergenic
1064528762 10:16285228-16285250 CTTGGGAGGTTGAGGTGGGAGGG - Intergenic
1064714020 10:18156784-18156806 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1065042497 10:21711636-21711658 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065126784 10:22581486-22581508 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065156010 10:22870860-22870882 CTCTGGAGGGTGAAGGAGGGAGG - Intergenic
1065353479 10:24816465-24816487 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1065625001 10:27621066-27621088 CTGGGGCTGTTGAAGAAGGCAGG - Intergenic
1065705752 10:28470118-28470140 CTTGGGAGGCTGAAGTAGGGAGG + Intergenic
1065789609 10:29248759-29248781 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1065801170 10:29353996-29354018 CTGGGAAGGTTGAGAGAGCAAGG - Intergenic
1065834626 10:29645460-29645482 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065949440 10:30638611-30638633 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1065983651 10:30928896-30928918 ATCAGGAGGTTGAAGGAGGAAGG - Intronic
1066188256 10:33031435-33031457 CTGGGGATGTTTTTGGAGGAAGG + Intergenic
1066241734 10:33542969-33542991 CTGGGCAGGATGGAGTAGGATGG + Intergenic
1066284490 10:33951294-33951316 TTTGGGAGGTTGAGGCAGGAGGG - Intergenic
1066320181 10:34295217-34295239 CTGGGGTGGGTGAAGCAGCAAGG + Intronic
1066363730 10:34756112-34756134 ATGGGGAGATTGGAGGAGGGAGG - Intronic
1066572376 10:36787647-36787669 CTCGGGAGGCTAAAGCAGGAGGG - Intergenic
1067412097 10:46073875-46073897 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
1067660540 10:48233776-48233798 GTGGGGAGGATGAAGGGGCAGGG - Intronic
1067666762 10:48285849-48285871 CAGGGGAGGGTGAAGAGGGATGG - Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1068164694 10:53313604-53313626 CTCGGGAGGCTGTGGGAGGATGG + Intergenic
1068547001 10:58358866-58358888 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1068707378 10:60091836-60091858 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1069506388 10:69002056-69002078 CTTGGGAGATTGAGGCAGGAGGG + Intronic
1069626384 10:69870418-69870440 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1069789670 10:71011591-71011613 CTGGGGAGGGTGTGGGAGGATGG + Intergenic
1069955612 10:72049379-72049401 CTCAGGAGGTTGAGGCAGGAGGG + Intergenic
1069993469 10:72328903-72328925 CTGAGGAGGTGGCAGGAGGTTGG + Intergenic
1070092240 10:73299313-73299335 CTAGGGAGGCTGAGGCAGGAGGG - Intronic
1070221292 10:74448209-74448231 CTTGGGAGGGTGAAGTGGGAGGG + Intronic
1070263192 10:74877883-74877905 GTGGGGAGGATGAAGCAGAATGG - Intronic
1070361308 10:75692092-75692114 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1070613759 10:77952977-77952999 CATGGGAGGCTGAAGCAGGAGGG + Intergenic
1071005069 10:80874816-80874838 CTGGTGAGGTTGCAGAAGAAAGG - Intergenic
1071165872 10:82805613-82805635 GTGGGGAGGTGTATGGAGGATGG + Intronic
1071237427 10:83665415-83665437 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1071284124 10:84128661-84128683 CTGGGGTTGTAGAAAGAGGAAGG - Intergenic
1071292994 10:84200900-84200922 CTGGGGACGTTGGAAGAGGGAGG - Intronic
1071312299 10:84354089-84354111 CTGGGGAGGCTGAGGCGGGAGGG + Intronic
1071502564 10:86214038-86214060 GTGGGGAGGTTGGAGGTGTAAGG - Intronic
1071741580 10:88364433-88364455 CTGGGGATGTAAAATGAGGATGG - Intronic
1071808987 10:89157475-89157497 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072299811 10:94048874-94048896 CTCGGGAGGCTGAAGTAGGGAGG - Intronic
1072311419 10:94159760-94159782 GTGGGGAGGGGGAAGGAGGGAGG - Intronic
1072333652 10:94377949-94377971 TTTGGGAGGTCGAAGCAGGAGGG - Intergenic
1072428401 10:95349933-95349955 CTGAGGAGGCTGAGGCAGGAGGG - Intronic
1072597225 10:96885487-96885509 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1072603898 10:96961042-96961064 GTGGGGAGGGTGGAGTAGGATGG + Intronic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1072897177 10:99376991-99377013 GTGGGGAGGAAGAAGGGGGAGGG - Intronic
1072999013 10:100272029-100272051 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1073062696 10:100741949-100741971 CCCGGGAAGTGGAAGGAGGAAGG + Intronic
1073297506 10:102450124-102450146 GTGGGGAGGAGGAAGGAGGGAGG + Exonic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073393392 10:103197921-103197943 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073643911 10:105279915-105279937 TTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074060563 10:109961779-109961801 TTGGGGAGGGTGGGGGAGGAAGG + Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074196594 10:111192525-111192547 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1074313353 10:112341280-112341302 CTAGGGAGGTTGAAAGAGTCTGG - Intergenic
1074748346 10:116558300-116558322 CTTGGGAGGCTGAGGCAGGATGG - Intronic
1074837747 10:117314917-117314939 CGTGGTAGGTTGAAGGAAGATGG + Intronic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074907993 10:117881820-117881842 CTGGGGAGGTTGAGGCTGTAGGG + Intergenic
1075024520 10:118974775-118974797 CTTGGGAGGCTGAAGCAGAATGG + Intergenic
1075133414 10:119760329-119760351 CTTGGGAGGCTGAAGGAAGAAGG + Intronic
1075187493 10:120276162-120276184 CTGGGGAGGATGAAGCATGCAGG - Intergenic
1075403406 10:122177459-122177481 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1075645218 10:124092470-124092492 GCGGGGAGGAGGAAGGAGGAGGG + Intronic
1075888447 10:125923633-125923655 CTTGGGAGGCTGAAGCAAGAGGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076290695 10:129343399-129343421 GTAGGGAGGTGGAAGGAAGATGG - Intergenic
1076393081 10:130118451-130118473 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1076565894 10:131398852-131398874 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1076736441 10:132461253-132461275 AGGAGGAGGATGAAGGAGGAGGG - Intergenic
1076931404 10:133534263-133534285 GTGGGGAGGTTGGAGCTGGAGGG + Intronic
1077003980 11:342189-342211 TTTGGGAGGCTGAGGGAGGAGGG - Intergenic
1077022662 11:425834-425856 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1077040825 11:521414-521436 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1077127942 11:952110-952132 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077204556 11:1336363-1336385 CAGGGGAGGTGGGAGGAGGGAGG - Intergenic
1077532877 11:3105523-3105545 GTGGAGAGGGTTAAGGAGGACGG - Intronic
1077587143 11:3462437-3462459 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1077590806 11:3489613-3489635 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1077619695 11:3709595-3709617 CTTGGGAGGTTGAGGTGGGAAGG + Intronic
1077927697 11:6698241-6698263 CTCAGGAGGTTGAAGTAGGAGGG + Intergenic
1078383588 11:10866632-10866654 CTTGGGAGGCTGAGGGGGGAGGG + Intergenic
1078601365 11:12734025-12734047 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079175708 11:18138098-18138120 CTGAGGTGGATGAAGGTGGAGGG + Exonic
1079181455 11:18197275-18197297 CTGAGGTGGATGAAGGTGGAGGG + Intronic
1079263760 11:18910482-18910504 CTGAGGTGGATGAAGGTGGATGG - Intergenic
1079265999 11:18933867-18933889 CTGAGGTGGATGAAGGTGGAGGG - Exonic
1079297317 11:19244799-19244821 CTGGGCAGGGTTAAAGAGGATGG + Intergenic
1079363198 11:19786880-19786902 CTGGGGAGGTGGACGGGGGTGGG + Intronic
1079398322 11:20085084-20085106 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079497887 11:21066844-21066866 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1080311161 11:30894302-30894324 CCGTGGTGGTTGAAGGAGGCTGG - Intronic
1080326935 11:31085973-31085995 TTTGGGAGGCTGAGGGAGGAGGG - Intronic
1080667920 11:34352025-34352047 CTGGGTAGTCTGAAGGATGAGGG - Intronic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1080807532 11:35668099-35668121 CTGGAGAGAGTGAAGGGGGAAGG + Intronic
1081356613 11:42121593-42121615 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
1081451733 11:43177362-43177384 CTTTTGAGGTTGAAGGATGAAGG - Intergenic
1081551333 11:44115295-44115317 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081662561 11:44896916-44896938 GTGGGTGGGTTGAGGGAGGAAGG + Intronic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1081698365 11:45135036-45135058 CTAGGGAGGCTGAGGCAGGAGGG + Intronic
1081828839 11:46087998-46088020 TTTGGGAGGCTGAAGGTGGATGG - Intronic
1082622421 11:55440381-55440403 GTGGGGTGGTGGGAGGAGGAGGG - Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1082858520 11:57831109-57831131 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1082891040 11:58139043-58139065 CTGGGAAGATGGGAGGAGGAAGG + Intronic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083186566 11:61021237-61021259 CTTGGGAGGCTGAAGCAGGGAGG + Intergenic
1083832434 11:65241489-65241511 CAGGGGAGGTTGAGGGTGGTGGG - Intergenic
1083964015 11:66031752-66031774 CTTGGGAGGCTAAAGGGGGAGGG - Intergenic
1084038745 11:66529710-66529732 GTGGGGAGGGTGCAAGAGGAGGG - Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084243134 11:67836449-67836471 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1084246528 11:67861400-67861422 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1084517713 11:69645468-69645490 CAGCGGTGGGTGAAGGAGGAGGG + Intronic
1084826153 11:71733101-71733123 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1084829852 11:71760493-71760515 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1085126807 11:74007537-74007559 CTCGGGAGGCTGAAGGTGGGAGG - Intronic
1085129551 11:74026394-74026416 CTGAGGAGGTTGGAAGAGGATGG + Intronic
1085251207 11:75145085-75145107 CTGGGGAGGCTGAAGTGGGGAGG - Intronic
1085263410 11:75222124-75222146 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1085291995 11:75407574-75407596 CTCGGGAGGCTGAGGTAGGATGG - Intronic
1085309207 11:75506303-75506325 CCAGGGAGGAAGAAGGAGGAGGG + Intronic
1085356027 11:75837906-75837928 CTTTGGAGGCTGAAGCAGGAGGG + Intronic
1085462418 11:76702127-76702149 CTGGGGGTGTTCACGGAGGATGG - Intergenic
1085488256 11:76887150-76887172 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
1085587675 11:77726406-77726428 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1085633155 11:78136427-78136449 TTCGGGAGGCTGAGGGAGGAAGG + Intronic
1085801433 11:79593644-79593666 CAGGGAAGGGTCAAGGAGGAAGG - Intergenic
1086383375 11:86283024-86283046 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1086445634 11:86867767-86867789 CTTGGGAGGTTGAAGAAGGAGGG + Intronic
1086457154 11:86970466-86970488 CTGGGGAGATGGAAGGATGCTGG - Intergenic
1087134829 11:94706134-94706156 CTGGGGAAGTGGAAGCAGGGAGG - Intergenic
1087472038 11:98587914-98587936 CTGGGGAGGCCTCAGGAGGAAGG + Intergenic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087779632 11:102288601-102288623 CGGGGGAGGTTGGGGGAGTAGGG - Intergenic
1088214846 11:107496602-107496624 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1088259910 11:107934324-107934346 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1088453887 11:110013506-110013528 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088734521 11:112717631-112717653 CTGGGGAGGCTGATGGAGATGGG + Intergenic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089156751 11:116408738-116408760 CGGGGGAGGTGGGGGGAGGAAGG - Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090078870 11:123597332-123597354 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090179116 11:124678652-124678674 CTTGGGAGGCTGAAGTGGGAAGG - Intronic
1090391055 11:126387567-126387589 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1091129196 11:133129798-133129820 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1091149676 11:133316210-133316232 CTGAGGTGGTTGAAGCAGAAGGG + Intronic
1091663166 12:2399442-2399464 ATGGGGAGCTTGAAAGGGGATGG + Intronic
1091682289 12:2535596-2535618 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1091916587 12:4274705-4274727 CCGGGGAGGTGGAGGGAGGAGGG + Intronic
1092190469 12:6516086-6516108 CTCGGGAGGCTGAAGTGGGAGGG + Intronic
1092413385 12:8271185-8271207 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1092611493 12:10178001-10178023 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1092624315 12:10310225-10310247 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1092696058 12:11172380-11172402 GTGGGAATGTTGAAGGAGGGCGG + Intergenic
1093200237 12:16177758-16177780 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1094111395 12:26866458-26866480 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1094186296 12:27646484-27646506 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1094555678 12:31497774-31497796 ATGGGGAGGGTGGAGGGGGAGGG + Intronic
1094599132 12:31893027-31893049 CTTGGGAGGTTGAGGCAGGCAGG + Intergenic
1094687536 12:32732986-32733008 CTGGGGAGGCTGAGGCAGGCAGG + Intronic
1094741906 12:33299298-33299320 CTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1095250748 12:39976638-39976660 CTTGGGAGGCTGAAGCAGGAAGG - Intronic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1095460333 12:42436786-42436808 TTGGGCAGGATGAAGCAGGATGG + Intronic
1095487863 12:42703231-42703253 CTGGGGAGGCTGAGGGAACAAGG + Intergenic
1095506887 12:42907751-42907773 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1095549437 12:43416626-43416648 CTCGGGAGGCTGAGGGAGAATGG - Intronic
1095583343 12:43824819-43824841 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1095616389 12:44194721-44194743 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1095665659 12:44794631-44794653 CTGGGGAGGTTGCAGATGGGAGG - Intronic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1095775488 12:46005107-46005129 CTGGGGAGGCTGAGGTGGGAGGG - Intergenic
1095846655 12:46753149-46753171 CTCAGGAGGTTGAATGAGGCTGG - Intergenic
1095882914 12:47157480-47157502 CTGGGGAGGTTGAGGCAGGAAGG + Intronic
1096131759 12:49164741-49164763 CTTGGGAGGTTGAGGCAGAAGGG + Intergenic
1096154329 12:49333338-49333360 CTGGGGAGGACCAGGGAGGAGGG + Intronic
1096160265 12:49370781-49370803 CTGGGCAGGTGGGAGGAGGTTGG - Intronic
1096332544 12:50726741-50726763 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1096441599 12:51648308-51648330 CTGAGGAGGCTGAGGCAGGAGGG - Intronic
1096473597 12:51894983-51895005 CTGAGCAGGTTGGAGGTGGAGGG - Intergenic
1096807888 12:54151416-54151438 CTAGGGAGTTTGGAGGGGGAAGG + Intergenic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097173806 12:57131333-57131355 CTGGAGAGGTTGCAGAAAGATGG + Intronic
1097178214 12:57155841-57155863 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1097192943 12:57228505-57228527 CTGGGAAGGTTGAGGCAGGAGGG - Intergenic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1097892606 12:64793095-64793117 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1098130395 12:67344336-67344358 CTTGGGAGGTTGAGGGTGGAAGG - Intergenic
1098299184 12:69036716-69036738 CTGCTCTGGTTGAAGGAGGAAGG - Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098357379 12:69624424-69624446 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1098554124 12:71799299-71799321 CTGGAAGGGTTGAAGGAGCAGGG - Exonic
1098654013 12:73006627-73006649 CTGCTAAGGTTGAAGGAGAAGGG + Intergenic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1098900223 12:76104737-76104759 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099135068 12:78887188-78887210 CTGGGCAGGATGGAGTAGGATGG - Intronic
1099271738 12:80519525-80519547 ATGGGCACTTTGAAGGAGGAGGG + Intronic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100404309 12:94260158-94260180 TTGGGGAGGCTGAGGCAGGAGGG - Intronic
1100406757 12:94278640-94278662 CTGAGGATGTTGAAAGCGGAGGG + Intronic
1100438243 12:94591646-94591668 CTCGGGAGGTTGAGGCACGAGGG + Intronic
1100504533 12:95206580-95206602 CTTGGGAGGCTGAAGGTGGGTGG + Intronic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1100847392 12:98674101-98674123 CTCAGGAGGTTGAAGCAGGAGGG - Intronic
1100927403 12:99565377-99565399 TTGGGGGGTTTGAAGAAGGATGG - Intronic
1100988876 12:100231065-100231087 CTGGGGAGGCTAAAGCAGGCAGG - Intronic
1100991019 12:100251513-100251535 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1101679656 12:106953294-106953316 CTTGGGAAGTTGAGGCAGGAAGG - Intergenic
1101731119 12:107427387-107427409 CTCGGGAGGTTGAGGCGGGAGGG - Intronic
1101759881 12:107649812-107649834 CTGGGGAGAGTGAAGGAAGCAGG - Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1101950980 12:109174760-109174782 CTGAGGAGGCTGAGGCAGGAGGG + Intronic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102219203 12:111182981-111183003 CCGGGCAGATTGAAGGAGGAAGG - Intronic
1102288827 12:111682388-111682410 CTTGGGAGGCTGAGAGAGGAAGG + Intronic
1102312547 12:111858004-111858026 CTGGGTAGGCTGAGGTAGGAGGG - Intronic
1102379697 12:112453888-112453910 TTTGAGAGGTTGAAGGAGGCAGG - Intronic
1102820159 12:115901793-115901815 CTGGGGATTTTGGAGGAGGACGG + Intergenic
1102879387 12:116472612-116472634 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1102928555 12:116845134-116845156 CTTGGGAGATTGAAGCAGGAGGG + Intronic
1102943752 12:116966824-116966846 CTCGGGAGGCTGAGGCAGGAAGG - Intronic
1102972719 12:117182983-117183005 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1102978221 12:117221751-117221773 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1102997668 12:117362224-117362246 CTGGGGAGAGTGAAGGATGGAGG + Intronic
1103166251 12:118773088-118773110 ATGGGGAGCGTGAAGGGGGATGG + Intergenic
1103270568 12:119669679-119669701 CTCGGGAGGCTGAGGCAGGATGG - Intronic
1103460609 12:121101800-121101822 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1103503792 12:121426551-121426573 CTGGGGAGGCTGAGGCGGGAGGG - Intronic
1103548144 12:121716198-121716220 CTAGGGAGGCTGGAGTAGGAGGG + Intronic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103638423 12:122328687-122328709 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1103755140 12:123199111-123199133 CTCAGGAGGTTGAGGCAGGAGGG - Intronic
1103788252 12:123449747-123449769 CTCGGGAGGCTGAAGTGGGAGGG + Intergenic
1104007306 12:124902676-124902698 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104373521 12:128244542-128244564 CTCTGGAGGCTGAAGGAAGATGG + Intergenic
1104408972 12:128542411-128542433 CTCGGGAGGTTTAGGCAGGAGGG - Intronic
1104555192 12:129793445-129793467 CTGGGGAGGTTGAGGCTGCAAGG - Intronic
1104648476 12:130514004-130514026 CTGGGGAGGCTGAAGGTGTGGGG - Intronic
1104991938 12:132629989-132630011 CTGGGGAGGCCCAAGGAGAAAGG + Intronic
1105073834 12:133257151-133257173 CTGGGGAGGTTGAGGCTGCAGGG + Intergenic
1105220098 13:18317738-18317760 CTTGGGAGGCTGAAGCAAGAGGG + Intergenic
1105392814 13:19996776-19996798 CTTGGGAGGCTGAAGCTGGAAGG + Intronic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1105796346 13:23857460-23857482 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1105874247 13:24539564-24539586 CTGGGGCTGCTGCAGGAGGAGGG - Intergenic
1105934516 13:25086757-25086779 CTCGGGAGGCTGAAGTTGGAGGG + Intergenic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1106234187 13:27847864-27847886 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1106356622 13:28989652-28989674 ATGGGGAGGATGAGGGTGGACGG + Intronic
1106458581 13:29948727-29948749 CTGTGGCGGTGGAAGGAGGTGGG - Intergenic
1106498325 13:30303455-30303477 CTGGGGAGGCTGAGACAGGAAGG + Intronic
1106526787 13:30547807-30547829 CTTGGGAGGCTGAAGCAGGGAGG + Intronic
1106638518 13:31557958-31557980 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1106709112 13:32311988-32312010 AAGGGGCGGATGAAGGAGGAAGG - Exonic
1106943245 13:34799685-34799707 CTGCTGAGGGTGAAGGAGAAGGG - Intergenic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1107757597 13:43641638-43641660 CTCGGGAGGCTGAAGGAGAATGG - Intronic
1107966298 13:45601306-45601328 CTTGGGAGGCTGAAGCGGGAAGG + Intronic
1108025125 13:46169690-46169712 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108756037 13:53503408-53503430 CGGGGTAGGTGGAAGGAGAAAGG - Intergenic
1110267831 13:73558487-73558509 CTTGGGAGGCTGAGGGAGGGAGG + Intergenic
1110284629 13:73735187-73735209 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110439372 13:75510028-75510050 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1110589324 13:77236788-77236810 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111006165 13:82252154-82252176 CTTGGGAGATTGAAAGATGATGG - Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111701013 13:91689058-91689080 CTTGGGAAGTTGAGGCAGGAGGG + Intronic
1111766289 13:92534177-92534199 CTTGGGAGGTTGAGATAGGATGG + Intronic
1112029066 13:95440431-95440453 TTGGGGAGGCTGAAGCAGGAGGG + Intronic
1112036500 13:95501419-95501441 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1112044691 13:95584386-95584408 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1112248771 13:97758626-97758648 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1112478656 13:99754307-99754329 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1112531670 13:100210083-100210105 CTTGGGAGGCTAAAGAAGGAGGG - Intronic
1113332916 13:109347925-109347947 CTTGGGAGGTTGAGGTGGGAGGG + Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113716656 13:112513944-112513966 CTGGCTAGGTTGGAGCAGGATGG - Intronic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1113973776 13:114211302-114211324 CTGGGGAGCATGAAGTGGGAGGG - Intergenic
1113980876 13:114274341-114274363 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1114178175 14:20342818-20342840 CTTGGGAGGCTGAAGCAGAATGG - Intergenic
1114513253 14:23279888-23279910 CTCAGGAGGTTGAGGCAGGAGGG - Intronic
1114843041 14:26288551-26288573 CTGGTGAGGTTGCAGGAAAAAGG - Intergenic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115831041 14:37341686-37341708 TTTGGGAGGTTGAGGCAGGAGGG - Intronic
1116116463 14:40658018-40658040 CTGGGAAGGATGCTGGAGGAAGG - Intergenic
1116285058 14:42960121-42960143 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1116562287 14:46395627-46395649 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1117139649 14:52775772-52775794 CTGGGGAGGCTGAGGCAGGAGGG + Exonic
1117171717 14:53107431-53107453 CTGGGCAGGATGGAGCAGGATGG + Intronic
1117381203 14:55165413-55165435 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1117390531 14:55258350-55258372 CTAGGGAGGCTGAAGTGGGAGGG - Intergenic
1117689836 14:58295255-58295277 CTGGGGAGGCTGAGGCAGAATGG + Intronic
1117705675 14:58464850-58464872 CTGGGCAGGATGGAGCAGGACGG + Intronic
1117717488 14:58595952-58595974 CTCCAGAGGTTGAAGCAGGAGGG - Intergenic
1117919669 14:60716187-60716209 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1117923844 14:60755104-60755126 CTTGGGAGGTTGAGGCAGAAGGG - Intronic
1118200357 14:63665695-63665717 CTTGGGAGGTTGAGGCAGGAGGG + Intergenic
1118287664 14:64491221-64491243 CTTGGGAGGATGAGGCAGGAGGG + Intronic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1118580090 14:67287108-67287130 CTGGGGAGGCTGAGGTGGGAAGG + Intronic
1118633008 14:67723339-67723361 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118715828 14:68559486-68559508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118749168 14:68794141-68794163 GTGGGGAGGATGGAGGAGGAGGG - Intronic
1118765506 14:68906878-68906900 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1118779460 14:68997419-68997441 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1118830519 14:69427108-69427130 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1119205194 14:72788719-72788741 AGGGGGAGGTTGATGGTGGAAGG + Intronic
1119303050 14:73585895-73585917 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1119325368 14:73756886-73756908 CTGAGGAGGTTCCAGGAGCAGGG + Intronic
1119483077 14:74971546-74971568 CTAGGGAGGCTGAGGTAGGAAGG + Intergenic
1119523018 14:75300136-75300158 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1119555157 14:75547362-75547384 CTAGGGAGGCTGAAGCAAGAGGG - Intergenic
1119663946 14:76470933-76470955 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1119818334 14:77591320-77591342 GTGGGGAGGGTGGATGAGGAAGG + Intronic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120002842 14:79323139-79323161 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1120531229 14:85633690-85633712 CTTGGGAGGTTGAAGCAGGAGGG + Exonic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120815618 14:88854788-88854810 CTTGGGAGACTGAAGCAGGATGG - Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1120920757 14:89753666-89753688 CTGGGGAGGTTGAGGCTGCAGGG - Intergenic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1121326960 14:93026026-93026048 CTCAGGAGGTTGAGGCAGGAGGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121585440 14:95060099-95060121 ATGGGGTGGTGGCAGGAGGATGG - Intergenic
1121622982 14:95363065-95363087 CAGGGAAGGTTGGATGAGGACGG - Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1122138379 14:99647443-99647465 GTGGGCAGGTGGATGGAGGAAGG + Intronic
1122223295 14:100256027-100256049 CTTGGGAGGTTGCAGCAGGAGGG + Intronic
1122258839 14:100500397-100500419 CTGTGGAGGGTGGAGAAGGAGGG + Intronic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122479982 14:102040849-102040871 CTCGGGAGGCTAAAGCAGGAAGG + Intronic
1122491602 14:102120119-102120141 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1122631236 14:103108712-103108734 CTGGTGGGGCTGATGGAGGATGG - Intronic
1122669566 14:103359998-103360020 CTCGGGAGGTTGAGGCAGGCAGG - Intergenic
1122740930 14:103871343-103871365 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
1122815644 14:104310801-104310823 GTGGGGTGGTTGAAGGGAGAGGG + Intergenic
1122853438 14:104548678-104548700 CTGGGGAGGATGTTGGAGCAGGG - Intronic
1202870224 14_GL000225v1_random:156086-156108 CTGGGGAGGCTGAAGTGGGTTGG - Intergenic
1123690071 15:22831237-22831259 CCGGGGAGGCTGACGCAGGAGGG - Intergenic
1123756417 15:23400752-23400774 CTTGGGAGGCTGAGTGAGGAGGG + Intergenic
1123814055 15:23958565-23958587 CTGATGAGGTTGCAGGAGAAAGG - Intergenic
1124025731 15:25963951-25963973 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1124584312 15:30991447-30991469 CTGGGGCGGTGGCAGGAGGTAGG + Exonic
1124887504 15:33700963-33700985 ACGGGGAGGCTGAGGGAGGAGGG - Exonic
1124945262 15:34259540-34259562 CTAGGGAGGCTGAGGTAGGAGGG + Intronic
1125338109 15:38647952-38647974 GTGGGGAGTTGCAAGGAGGAGGG + Intergenic
1125431467 15:39599031-39599053 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1125542447 15:40477771-40477793 CTGTGGAGGATAAAGGAGAAGGG + Intergenic
1125611793 15:40976393-40976415 CTGGGGGGGTGGTAGGAGGGTGG + Intergenic
1125612333 15:40980014-40980036 CTGGGGTGCCTGTAGGAGGAAGG - Exonic
1125883607 15:43212788-43212810 CTGGGAAGCTAGAAGCAGGAGGG + Intronic
1125987871 15:44073024-44073046 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126752976 15:51895998-51896020 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126791681 15:52227300-52227322 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1126876378 15:53045945-53045967 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127136716 15:55931908-55931930 CTGGGAAGGTTGAGGGAAAATGG - Intronic
1127205377 15:56711555-56711577 CTCGGGAGGCTGAAGAAGAATGG + Intronic
1127503507 15:59576632-59576654 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1127523009 15:59761937-59761959 CTGGGGAGGCTGAGGCAGGAAGG - Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128071032 15:64797360-64797382 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128270559 15:66305630-66305652 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1128395978 15:67226238-67226260 TTGGGGAGGCTGAAGCAGGAAGG - Intronic
1128563413 15:68683249-68683271 GTGGGGAGCCTGAAGGACGAAGG + Intronic
1128783360 15:70377421-70377443 GAGGGGAGGTTGGAGGAGGAAGG - Intergenic
1129006607 15:72378909-72378931 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1129048923 15:72761804-72761826 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1129084011 15:73069059-73069081 CTTGGGAGGCTGAAGGGGGGAGG - Intronic
1129201218 15:74001894-74001916 TTTGGGAGGTTGAGGCAGGAGGG + Intronic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129390922 15:75220594-75220616 CTGAGGTGCCTGAAGGAGGAAGG + Intergenic
1129450990 15:75651357-75651379 TTGGGGAGGTGGCAGGAGGAAGG - Intronic
1129663644 15:77567186-77567208 ATGGGGTGGGTGCAGGAGGAGGG + Intergenic
1129772491 15:78211734-78211756 CTGGCAAGGTAGAAGGAGTAAGG - Intronic
1129810322 15:78505215-78505237 CTCGGGAGGCTGAAGCAGAATGG - Intergenic
1130160764 15:81397766-81397788 CTGGGGAGATTATAGAAGGAAGG - Intergenic
1130358154 15:83154226-83154248 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130616840 15:85418181-85418203 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1131019483 15:89086520-89086542 GTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1131059016 15:89393011-89393033 CTGAGGAGGTTGCAGGATGCGGG + Intergenic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1131254927 15:90855681-90855703 TTGGGGAGGCTGAAGCAGGTGGG + Intergenic
1131278657 15:91003393-91003415 GTGGGGAGGATGCAGCAGGAGGG + Intronic
1131416184 15:92260646-92260668 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131785409 15:95906591-95906613 AAGGGGAGGGTGAGGGAGGAGGG + Intergenic
1132085554 15:98905554-98905576 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1132616193 16:842174-842196 GTGGGGCGGTTGACTGAGGAGGG + Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132686497 16:1164437-1164459 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1132764233 16:1526315-1526337 CTGGGGAGGCTGTGGGAGGGGGG - Intronic
1132820050 16:1861648-1861670 CTAAGGAGGCTGAAGCAGGAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132896165 16:2230372-2230394 CTGGGCAGGTTGAGGGAGCTAGG + Intronic
1133213648 16:4277245-4277267 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1133356180 16:5138701-5138723 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1133357581 16:5147984-5148006 CTGGGGAGGCTGAGGTAGGGAGG + Intergenic
1133405746 16:5523176-5523198 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1133463538 16:6008095-6008117 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133542189 16:6766959-6766981 CGGGGGAGGCTGAAGGCTGAAGG + Intronic
1133715414 16:8442703-8442725 CTCGGCAGGTGGAAGGTGGAAGG + Intergenic
1133720353 16:8488941-8488963 TTGGGGTGGGTGGAGGAGGAAGG + Intergenic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134002957 16:10796945-10796967 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1134063832 16:11214108-11214130 CTTGGGAGGGTGAAGCAGGAGGG + Intergenic
1134237940 16:12482407-12482429 CTTGGGAGGCTGAAGCAAGAGGG - Intronic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134303275 16:13010068-13010090 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
1134357836 16:13500900-13500922 CTCTGGAAGTTGCAGGAGGATGG + Intergenic
1134448686 16:14349822-14349844 CTGGGGTGGCTGAGGCAGGAGGG - Intergenic
1134620322 16:15683917-15683939 CTCGGGAGGTTGAGGTAAGAAGG + Intronic
1134776610 16:16859006-16859028 CTCGGGAGGCTGAAGCAGGAGGG - Intergenic
1135285217 16:21187429-21187451 CTCGGGAGGTTGAGGCAAGAGGG + Intergenic
1135570529 16:23545769-23545791 CTCGGGAGGTTGAGGCAGGAGGG - Intronic
1135614940 16:23903071-23903093 TTGGGGAGGCTGAAGCAGGAGGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136042312 16:27589883-27589905 CTTGGGAGGGTGAGGCAGGAGGG - Intronic
1136086993 16:27892345-27892367 CTTGGGAGGTTGAGGTGGGAGGG + Intronic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136289837 16:29264884-29264906 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1136463368 16:30425699-30425721 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136521468 16:30799112-30799134 CTCGGGAGGATGAAGTGGGAGGG - Intergenic
1136527752 16:30843451-30843473 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137621587 16:49879951-49879973 CTGGGGAGGGTGAATGGGCAGGG + Intergenic
1137639699 16:50017817-50017839 CTGGGGAGGTGGTGGGGGGATGG - Intergenic
1137745331 16:50816265-50816287 CTTGGGAGGTTGTTGGAGAATGG - Intergenic
1137759306 16:50927681-50927703 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1138438712 16:57021465-57021487 CTTGGGAGGCTGAAGTGGGAAGG - Intronic
1138447513 16:57073699-57073721 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138550230 16:57743860-57743882 CTGTGGCGGTTGGAGGAGGGTGG - Intronic
1139020927 16:62748386-62748408 TGAGGGAGGTAGAAGGAGGAAGG - Intergenic
1139324187 16:66139321-66139343 CTAGGGAGGCTGAGGGGGGAGGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139407853 16:66733595-66733617 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1139787018 16:69401587-69401609 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140230577 16:73114165-73114187 TTTGGGAGGTTGAAGTGGGAGGG - Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140358360 16:74324654-74324676 CTCAGGAGGTTGAGGCAGGAAGG + Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140733826 16:77880262-77880284 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1140932634 16:79641883-79641905 CTCGGGAGGTTGAGGCAAGAGGG - Intergenic
1141295746 16:82767579-82767601 CTGGGGAAGTTAAAGGGGGCAGG - Intronic
1141515237 16:84539711-84539733 CTCGGGAGGATGAGGGAGGCTGG + Intronic
1141571804 16:84938638-84938660 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1141641361 16:85343504-85343526 TTTGGGAGGTTGAAGCAGGAAGG + Intergenic
1141651709 16:85396432-85396454 CTGGGGAGGTGGAAGGGGTGTGG - Intergenic
1141844970 16:86602190-86602212 CTCGGGAGGCTGAGGCAGGATGG - Intergenic
1141877947 16:86839025-86839047 CCGGGCAGGAGGAAGGAGGAAGG + Intergenic
1141911581 16:87063228-87063250 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1142095721 16:88238360-88238382 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1142365838 16:89649214-89649236 GTGGGGAGGTTGAGGGAAGCTGG - Intronic
1203143820 16_KI270728v1_random:1786438-1786460 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1142503141 17:345169-345191 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1142534138 17:602068-602090 TCGGGGAGGTTGCAGGAAGAGGG - Intronic
1142537031 17:625352-625374 CTTGGGTGGCTGAAGCAGGAGGG + Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142694369 17:1625258-1625280 CTGGTGAGGTGGCAGAAGGAAGG - Intronic
1142962379 17:3558855-3558877 CTGGGGAGGAGGCAGGAGGCAGG + Intergenic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143088215 17:4432913-4432935 CTTGGGAGGCTGAGGTAGGAAGG - Intergenic
1143197842 17:5089761-5089783 CTGGGGAGGCTGAGGTAGGAGGG - Intronic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1144063243 17:11601788-11601810 ATGGGGAGGTGGAAGGAAAAGGG - Intronic
1144346328 17:14353267-14353289 ATGGGGAAGTTGAAGGACAAGGG + Intergenic
1144573623 17:16415852-16415874 CTGGGGACGTTGGAGGGGGCCGG + Intronic
1144575974 17:16429727-16429749 CTGGGGAGATGGCAGGAGGGTGG + Intronic
1145878342 17:28336202-28336224 CCGCGGAGGTGGAAAGAGGAGGG - Intronic
1145985120 17:29040769-29040791 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1145989451 17:29070090-29070112 CTAGGGGGGATGAAGGGGGAGGG + Intergenic
1145994984 17:29099934-29099956 CTGGGAAGGTTGAGGGAGAAGGG + Intronic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146162009 17:30565117-30565139 ATGGGCAGGATGAAGGAGGGAGG - Intergenic
1146421105 17:32686755-32686777 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1146438054 17:32869823-32869845 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1146459010 17:33029050-33029072 GTGGGAAGGGTGAAGGATGAGGG + Intronic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1146762539 17:35490999-35491021 CTGGGGAGGCCGGAGGAGAAAGG - Intronic
1146832222 17:36080014-36080036 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1146892503 17:36515051-36515073 CTGGGGAGGTTGAAAGTGGCTGG - Intronic
1146954378 17:36928632-36928654 CTGGGGAGGTTGATGGTACAAGG - Intergenic
1147017749 17:37506155-37506177 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1147186094 17:38713765-38713787 CTGGGGCGAGTGGAGGAGGATGG - Intronic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147392631 17:40119827-40119849 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1147461619 17:40575654-40575676 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147717542 17:42518580-42518602 CTCGAGTGGGTGAAGGAGGAAGG - Intronic
1147875657 17:43618675-43618697 GTGGGGAGGTTAAGGGAGGGTGG - Intergenic
1148136578 17:45296415-45296437 CTTGGGAGCCTGAAGCAGGAGGG + Intronic
1148144707 17:45355804-45355826 CTAGGGTTTTTGAAGGAGGAAGG + Intergenic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148476352 17:47931233-47931255 CTTGGGAGGTTGAGGCAGGCAGG + Intergenic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148617403 17:49011579-49011601 CTCTGGAGGTTGAGGCAGGAAGG + Intronic
1148666953 17:49382186-49382208 CTGAGGAAGTTGGAGGAGAAAGG - Intronic
1148799910 17:50217519-50217541 CTCAGGAGGTTGAGGCAGGAGGG - Intergenic
1148875699 17:50685872-50685894 CTGGGGAGGGTGCATGAGTATGG - Intronic
1149032935 17:52104304-52104326 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149464988 17:56871036-56871058 CTCGGGAGGCTGATGGAGGAGGG + Intergenic
1149543014 17:57482670-57482692 CTCGGGAGGTTAAAGAAGGAAGG - Intronic
1149595918 17:57864635-57864657 CTGCAGTGGATGAAGGAGGATGG + Intronic
1150055391 17:62010112-62010134 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1150209766 17:63435628-63435650 CCAGGGAGGTGGGAGGAGGAGGG - Intronic
1150266283 17:63834320-63834342 CTGGGGAGGCTGGAGTTGGATGG + Exonic
1150397519 17:64832864-64832886 CTCGGGAGGCTGAGGGAGAATGG + Intergenic
1150433005 17:65133576-65133598 CTTGGGAGGCTGAATGAGGCAGG - Intergenic
1150446652 17:65231787-65231809 CTGGGAAGGCTGAAGGAAGCCGG + Intergenic
1150472125 17:65446352-65446374 CTGGGAAGGCTGCAGGAAGAGGG + Intergenic
1150510949 17:65752539-65752561 CTGGAGAGGTGGAATGAGAAAGG - Intronic
1150613610 17:66752488-66752510 CTCAGGAGGTTGAGGCAGGAGGG + Intronic
1150680055 17:67277484-67277506 GCGGGGAGGTTGAGGGGGGAGGG - Intergenic
1151009971 17:70483320-70483342 CTGGGGTGGTTGGGGGAGGAGGG + Intergenic
1151398423 17:73840259-73840281 CTGAAGAGGTTGCATGAGGAAGG + Intergenic
1151446867 17:74172070-74172092 CTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1151454557 17:74218213-74218235 CAAGGGAGGAGGAAGGAGGAGGG - Intronic
1151530291 17:74699896-74699918 CTTGGGAGGCTGAAGTAGGCAGG + Intronic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1151818182 17:76481844-76481866 CTCGGGAGGCTGAGGCAGGATGG + Intronic
1151893971 17:76967920-76967942 CTGAGGAGGCTGAAGTGGGAGGG - Intergenic
1151918752 17:77138502-77138524 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1151925674 17:77194445-77194467 CTGGGGAGGCTGAGGTAGGATGG + Intronic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152089242 17:78237822-78237844 ATGGGGAGGCTGAGGGAGGGAGG - Intronic
1152123111 17:78430986-78431008 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1152780101 17:82223618-82223640 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153038300 18:785827-785849 CTTGGGAGGCTGAAGTAGGGAGG + Intronic
1153063803 18:1022089-1022111 TTGGGGAGGGTGAAGCAGGCAGG - Intergenic
1153283402 18:3435302-3435324 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1153460564 18:5328276-5328298 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1153469754 18:5430669-5430691 CTCAGGAGGCTGAGGGAGGAGGG - Intronic
1153842753 18:9021945-9021967 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1153938067 18:9949260-9949282 CTGGGAAGCTTGAAGAAGAATGG + Intronic
1154200155 18:12293984-12294006 CTGGGGTGGGTGGAGGATGAAGG + Intergenic
1155133458 18:22962703-22962725 CTAGGGAGGTTGAGGTAGGGGGG - Intronic
1155152336 18:23133260-23133282 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1155309591 18:24510617-24510639 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1155492255 18:26410671-26410693 CTGGGGAGGTGGTAGGGGGAGGG + Intergenic
1155503887 18:26514308-26514330 CTTGGGAGGCTGAAGTAGGAGGG + Intronic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155788639 18:29934799-29934821 CTGGGGAGGCTGAGGCAAGAAGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156469467 18:37368378-37368400 GTGGGGAGGATCAAGGCGGAGGG - Intronic
1156491815 18:37500888-37500910 CTGGGGAGGCTGAAGCACGTAGG + Intronic
1157262842 18:46191422-46191444 CTTGGGAGGTTGAGGCATGAGGG - Intronic
1157327911 18:46682116-46682138 CTGGGGAGGGTGCAGGGGGAGGG + Intronic
1157398386 18:47364101-47364123 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1157404861 18:47414266-47414288 GTGTGGAGGTTGGAGAAGGAGGG + Intergenic
1157460830 18:47891630-47891652 CTTGGGAGGTTGAGGCAGGAGGG - Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158215715 18:55098547-55098569 CTAGGGAGGCTGAAGTGGGAGGG - Intergenic
1158462886 18:57662139-57662161 CTCTGGAGGTTGAAGCAGGAGGG - Intronic
1158513196 18:58109676-58109698 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1158561311 18:58516109-58516131 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1158574281 18:58623159-58623181 CTGGCTGGGTTGAAGGATGAGGG - Intronic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1160063137 18:75550205-75550227 CTGGGAAGGTTGAAGCAACAGGG + Intergenic
1160178645 18:76615895-76615917 CAGGGAAGGTGGAAGGGGGATGG + Intergenic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160319244 18:77875055-77875077 CTGGGCGGGTGGATGGAGGAGGG - Intergenic
1160328089 18:77968753-77968775 CTGGGAAGGTTGAAGGGGGCTGG - Intergenic
1160433372 18:78827632-78827654 CTGGGGAGGTGGAATGGGGGTGG - Intergenic
1160444954 18:78920276-78920298 CTGGGGGGGTTGGAGGGGGATGG - Intergenic
1160718380 19:586712-586734 CTGGGGAGGTTCAGCGAGGAGGG + Intergenic
1160781823 19:880811-880833 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
1160816196 19:1036963-1036985 CTCGGGAGGCTGAGGCAGGAAGG - Intronic
1160841413 19:1148471-1148493 CTGGGGTGGGTGAAGGAGGGTGG - Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1161012694 19:1968080-1968102 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012730 19:1968188-1968210 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012789 19:1968358-1968380 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161031099 19:2058111-2058133 CCTGGGAGGTTGAGGGAGGTGGG - Intergenic
1161186178 19:2922454-2922476 CTGAGGAGGTGGCTGGAGGAGGG + Intergenic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161268180 19:3374857-3374879 CTGGGGAGGACAAGGGAGGATGG + Intronic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1161535176 19:4814757-4814779 TTTGGGAGGTTGAAGTGGGAGGG - Intergenic
1161632399 19:5364813-5364835 CAGGGGATGTGGAACGAGGATGG + Intergenic
1161717937 19:5887246-5887268 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1161868025 19:6848899-6848921 CTGGGGAGGCTGAGCTAGGAGGG - Intronic
1162050892 19:8032127-8032149 CTTGGGAGGTTGAAGTGAGAGGG + Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1162224651 19:9210362-9210384 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1162295109 19:9807970-9807992 CTTGGGAGGCTGAAGTAGGATGG + Intergenic
1162355367 19:10180202-10180224 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
1162407106 19:10481486-10481508 CTCGGGAGGCTGAAGCAGAATGG + Intergenic
1162419175 19:10556178-10556200 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1162567924 19:11454291-11454313 CTGGGGTGGGGGCAGGAGGATGG + Exonic
1162749693 19:12821307-12821329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1162766507 19:12923035-12923057 CTGGTGTGGCTGAAGGCGGAGGG - Intronic
1162832697 19:13296865-13296887 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163036857 19:14574802-14574824 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1163077521 19:14907880-14907902 CTGGGGCAGTTGAGGGAGAAGGG + Intergenic
1163119219 19:15206539-15206561 CTCGGGAGGCTGAGGAAGGAGGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163275549 19:16281750-16281772 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1163278705 19:16301973-16301995 CTGGGCTGTTTGCAGGAGGAAGG - Intergenic
1163306727 19:16484623-16484645 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1163572656 19:18091365-18091387 CGGGGGCGGGTGAAGCAGGAAGG + Intronic
1163586468 19:18167026-18167048 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
1163678984 19:18669782-18669804 TTGGGGTGGGTGGAGGAGGAGGG + Exonic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1163693682 19:18751414-18751436 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1164228908 19:23270655-23270677 TTTGGGAGGTTGGAGGTGGACGG - Intergenic
1164484929 19:28647203-28647225 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
1164886357 19:31782038-31782060 CTCTGGAGGCTGATGGAGGAGGG - Intergenic
1164948938 19:32319968-32319990 CTTGGGAGGATGAGGTAGGAGGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165450688 19:35880453-35880475 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1165477766 19:36041202-36041224 CTCGGGAGGCTGAAGTGGGAGGG + Intronic
1165571239 19:36776495-36776517 CTCGGGAGGCTGAAGCAGGAGGG - Exonic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1165789441 19:38482838-38482860 CTGGGAAAGTTGGAGGAGGTTGG + Intronic
1165798930 19:38536043-38536065 CTGGGCATGGTGAATGAGGATGG + Exonic
1165885930 19:39078312-39078334 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1165990682 19:39811054-39811076 CTCGGGAGGCTGAAGTGGGAGGG - Intergenic
1166116432 19:40658077-40658099 CTCGGGAGGCTGATGCAGGAGGG - Intergenic
1166292780 19:41873721-41873743 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1166340572 19:42134489-42134511 GAGGGGATCTTGAAGGAGGATGG + Intronic
1166382787 19:42363358-42363380 CCAGGGAGATGGAAGGAGGAGGG - Intronic
1166422902 19:42652506-42652528 GTGGGGAGCTTGGAGGAGCAAGG - Intronic
1166571957 19:43802646-43802668 CTGGGAGGGGTGAAGGAAGAAGG - Intronic
1166617839 19:44267095-44267117 GGAGGGAGGTAGAAGGAGGAAGG - Intronic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1166706635 19:44911704-44911726 CTCAGGAGGTTGAGGCAGGAGGG - Intergenic
1166742893 19:45124861-45124883 CTTGGGAGGTTGAGGTGGGAGGG + Intronic
1166819396 19:45568295-45568317 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1166894315 19:46014670-46014692 CTGGCGAGGTGGGAGGAGGAGGG + Intronic
1167013979 19:46827612-46827634 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1167073349 19:47233476-47233498 CTGGGGAGGCTGAGGCAGAAAGG - Intergenic
1167093018 19:47357784-47357806 CTGGGGAGGCTGCAGGCTGACGG - Intronic
1167610086 19:50503012-50503034 CTGGGGAGGCTGACGCAGAATGG - Intergenic
1167633476 19:50639751-50639773 CTGGGGCTGTGGCAGGAGGAGGG + Intronic
1167653658 19:50748822-50748844 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168062916 19:53903633-53903655 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1168223814 19:54980301-54980323 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1168337345 19:55604104-55604126 CTCCGGAGGCTGAAGCAGGAGGG - Intergenic
1168416747 19:56174238-56174260 CTGGGAAGGAGAAAGGAGGAGGG - Intergenic
1168709398 19:58490051-58490073 CTGGGGAGGCTGAAGTGGGAGGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925318188 2:2940730-2940752 CCAGGGAGGTTGAAGGAGGGAGG - Intergenic
925377539 2:3398961-3398983 CAGGGGAGGTGGGAGGGGGAGGG - Intronic
925450749 2:3967468-3967490 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926200074 2:10788546-10788568 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
926289728 2:11518990-11519012 CTTGGGAGGCTGAGGCAGGATGG + Intergenic
926290824 2:11528607-11528629 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
926650476 2:15338765-15338787 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
926853431 2:17226448-17226470 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
926895148 2:17678666-17678688 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
927521435 2:23701108-23701130 ATGGGAAGGTTGAGGGAGGAGGG - Intronic
927556381 2:24036397-24036419 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
927806543 2:26151631-26151653 CTTGGGAGGTTGAAATAGAAGGG + Intergenic
927839853 2:26433695-26433717 CTGGGGTGGGTGTAGGAGGTAGG + Intronic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
928162385 2:28939997-28940019 CTCGGGAGGCTGAGGGAGGCAGG + Intronic
928545779 2:32328012-32328034 CTTGGGAGGATGAGGCAGGAGGG - Intergenic
928625537 2:33135966-33135988 CTGGGGGGGTGGTAGGAGAAGGG + Intronic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929167685 2:38900082-38900104 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
929362633 2:41112716-41112738 ATGGGGGGGATGAAAGAGGAAGG - Intergenic
929562138 2:42962530-42962552 CTGGAGGGGTTGGGGGAGGAGGG + Intergenic
929575961 2:43051902-43051924 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
929682225 2:44003324-44003346 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
929754186 2:44750262-44750284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
929906221 2:46048852-46048874 CTGGGAAGGAGAAAGGAGGAGGG - Intronic
929981648 2:46686989-46687011 CTGGTGAAGTTAAAGAAGGAAGG - Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931215459 2:60238426-60238448 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
931236656 2:60418328-60418350 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
931236673 2:60418392-60418414 CTGCTGAGGGTGAAGGAGAAGGG - Intergenic
931250690 2:60528471-60528493 CTGGGCATATTGAAGGAGCACGG - Intronic
931420252 2:62120828-62120850 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
931473232 2:62561519-62561541 CCAGGGAAGTTGAAGGGGGAGGG - Intergenic
931588704 2:63857191-63857213 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
932381758 2:71290504-71290526 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
932722528 2:74148128-74148150 CTGGGGAGACTGAAGGAGAGCGG - Intergenic
933087765 2:78077202-78077224 TTTGGGAGGCTGAAGTAGGAGGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933432773 2:82205285-82205307 TTCAGGAGGTTGAAGCAGGAGGG + Intergenic
933481393 2:82861382-82861404 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933665511 2:84961362-84961384 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
933792670 2:85895562-85895584 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933809530 2:86024351-86024373 CTGGGGAGGTGGAAGGAATAGGG + Exonic
933820608 2:86108016-86108038 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
934062718 2:88310359-88310381 CTCGGGAGGCTGAAGTGGGAGGG + Intergenic
934183947 2:89654751-89654773 CTTGGGAGGCTGAAGCAAGAGGG - Intergenic
934294237 2:91728916-91728938 CTTGGGAGGCTGAAGCAAGAGGG - Intergenic
934533312 2:95110692-95110714 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
934605700 2:95693667-95693689 CTGGGGAGGTTGTGGGAACAAGG + Intergenic
934782757 2:96982674-96982696 CTCAGGAGGTTGAGGCAGGAGGG - Intronic
934785222 2:97000223-97000245 GTGGGGAGGCTGAAGTGGGAGGG - Intronic
934873651 2:97892466-97892488 CTTGGGAGGATGAAGCAAGAGGG - Intronic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
934976350 2:98805555-98805577 CTCTGGAGGGTGGAGGAGGAGGG - Intronic
935122565 2:100195835-100195857 TAGGGGAGTTGGAAGGAGGAGGG + Intergenic
935191465 2:100781920-100781942 CTGGGGAGGGAGAAGGAGAGAGG - Intergenic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935298199 2:101669180-101669202 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
935444921 2:103146185-103146207 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
935580219 2:104750147-104750169 CTGTGGAGGTTGAAGGGGGGAGG + Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
935729044 2:106049753-106049775 TTTGGGAGGCTGAAGGAGGGGGG + Intergenic
935735726 2:106105383-106105405 ATGCGGAGGTGGCAGGAGGAGGG + Intronic
935901568 2:107798763-107798785 ATGGGGAGGATGAAGGAAGCTGG + Intergenic
935987732 2:108690831-108690853 CTGGGGAGGTTGAGGCAGGAGGG - Intergenic
936042994 2:109163976-109163998 CTGGAGAGGATGTAGGGGGAAGG - Intronic
936126560 2:109793535-109793557 CTGGGGAGGTTGAGGCAGGAGGG - Intronic
936218133 2:110577933-110577955 CTGGGGAGGTTGAGGCAGGAGGG + Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936732555 2:115401473-115401495 CTTGGGAGGTTGAAGTGGGAAGG + Intronic
936737369 2:115462835-115462857 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
936956252 2:118025285-118025307 CTCAGGAGGTTGAGGCAGGAGGG - Intergenic
937157122 2:119728919-119728941 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
937207918 2:120248507-120248529 TTGGAGAGATTGCAGGAGGAAGG - Intronic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937307328 2:120880452-120880474 CGGGGAAGGAGGAAGGAGGATGG - Intronic
937358676 2:121214065-121214087 CAGGGGAGGTCAGAGGAGGAGGG - Intergenic
937716996 2:125043571-125043593 TTTGGGAGGTTGAGGCAGGAGGG + Intergenic
938014509 2:127856480-127856502 CTTGGGAGGCTGAGGCAGGATGG + Intronic
938186125 2:129233495-129233517 CTAGGGATTTTGAAGCAGGAGGG - Intergenic
938239605 2:129733203-129733225 TTGGTGAGGCTGGAGGAGGAGGG - Intergenic
938246246 2:129780024-129780046 CTGGGGAGCCTGAATGAGGGTGG - Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938265313 2:129923835-129923857 CTGGGGAGATTGAGGCAGGTAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938990183 2:136619886-136619908 CTGGTGAGGTTGCAGAAAGAAGG - Intergenic
939397913 2:141655100-141655122 CTGGGGAGGAGGAAGAGGGACGG + Intronic
939448608 2:142341957-142341979 CTGGGGAGAATGAAAAAGGATGG + Intergenic
939524568 2:143276688-143276710 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
939629322 2:144515092-144515114 CGAAGGAGGTGGAAGGAGGAAGG + Intronic
939871309 2:147529058-147529080 CTGGGCTGGTGGAAGGAGTAGGG - Intergenic
939894497 2:147775455-147775477 CTGGGGAGGTTGAAGCCAAAGGG - Intergenic
939983347 2:148806596-148806618 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
940182561 2:150952008-150952030 CTTGGGAGGTTGAAGCAAGAGGG + Intergenic
940267021 2:151849516-151849538 CTCAGGAGGTTGAAACAGGAAGG - Intronic
941020975 2:160407705-160407727 GTGCGGAGGTCGAAGGCGGAGGG - Intronic
941101233 2:161297836-161297858 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
941495467 2:166195938-166195960 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
941797085 2:169611098-169611120 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
941827605 2:169917312-169917334 CTGGACAGGGTGAAGAAGGAGGG - Intronic
941923735 2:170875706-170875728 CTGAGGAGGGTAAAGGAGGTTGG - Intergenic
941986821 2:171518629-171518651 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
943046156 2:182864782-182864804 CTGCGCAAGTTGAAAGAGGAAGG + Intronic
943340632 2:186676494-186676516 CTGGGGAGGCTGAAGCATGGAGG + Intronic
943536260 2:189154538-189154560 CTAGGGAGGGTGAGGGAAGAGGG - Intronic
943656877 2:190519327-190519349 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
944143259 2:196479690-196479712 CTGGAGAGGTTGCTGGTGGAGGG - Intronic
944412568 2:199458217-199458239 CTGGGGAGGTTGCGGGGGGAGGG + Intronic
944414568 2:199469143-199469165 GAAGGGAGGGTGAAGGAGGAGGG + Intronic
944603589 2:201329301-201329323 CTGGTGAGGTTGGAGGAAAAAGG + Intronic
944626915 2:201579957-201579979 CTTGGGAGGTTGAGGCAGAAGGG - Intronic
944670482 2:201990236-201990258 CTTGGAAGGTTGAGGCAGGAGGG + Intergenic
944781333 2:203021031-203021053 CTCGGGAGGCTGAGGGAGGCAGG - Intronic
944794013 2:203163573-203163595 TTTGGGAGGATGAAGGAGGAAGG - Intronic
944845483 2:203663955-203663977 TTGGGGAGGCTGAAGGGGGCAGG - Intergenic
944875018 2:203954479-203954501 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
944898391 2:204189065-204189087 CTGGGCAGGTGGCAGGAGAAAGG + Intergenic
945302278 2:208225675-208225697 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
945717475 2:213377702-213377724 CTGGCAAGGTTGAAGGTGCAAGG + Intronic
945846976 2:214957311-214957333 CTGAGGAGTTTGCAGGAAGATGG + Intronic
945923064 2:215776139-215776161 CAGGGCAGATTAAAGGAGGAAGG + Intergenic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946253938 2:218429961-218429983 CGGGGGAGGGTCCAGGAGGAGGG + Intronic
946298433 2:218805906-218805928 CTGAGGAGCATGAAGGAAGAAGG + Intronic
946302577 2:218832801-218832823 ATGGGGAGGGTGGAGGAGAATGG + Intergenic
946332873 2:219020151-219020173 CTGGGGAGGGTGAATGGGGAGGG - Intronic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947355996 2:229296186-229296208 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
947401890 2:229739565-229739587 CTCGGGAGGCTGAGGTAGGAAGG + Intergenic
947677487 2:231996045-231996067 CTAGAGAGGTTCAAGAAGGAAGG + Intronic
947708626 2:232296269-232296291 CTGGTGAGGTGAAAGGAGCATGG + Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947760947 2:232603418-232603440 AGGAGGAGGTGGAAGGAGGAAGG + Intergenic
948214926 2:236221571-236221593 CTGGGGAGGTGGAAGGTGAAAGG - Intronic
948220502 2:236265754-236265776 TTGGGCAGGTGGAAGGAGAATGG - Intergenic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948421795 2:237864487-237864509 CGGGGGAGGTGGATGGATGAGGG + Intronic
948458681 2:238118898-238118920 CGGAGGAGGTGGATGGAGGAGGG + Intronic
948756950 2:240165539-240165561 CCTGGGAAGTGGAAGGAGGATGG + Intergenic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948874920 2:240821056-240821078 CTGGGACGGTGGAGGGAGGACGG - Intergenic
948948285 2:241232974-241232996 CTGGGGAGGAAGAAGGGGAAGGG + Intronic
949010894 2:241677733-241677755 CTGCTGAGATTGAAGGAGGCAGG + Intronic
1168901494 20:1368893-1368915 TTGGGCAGGGTGAAGGAGGGTGG - Intronic
1169064401 20:2686182-2686204 CTGGGGAGGTAGGAGGAGGGTGG - Intergenic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169477745 20:5947941-5947963 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1169864525 20:10185673-10185695 GTGGTAAGGTGGAAGGAGGAAGG + Intergenic
1169867852 20:10219409-10219431 CTGGGGAGGCGAAAGGAGAAAGG + Intronic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170632377 20:18076570-18076592 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1170837605 20:19897954-19897976 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171284491 20:23925944-23925966 GTGGGGAGGGAGAAGGAGGGAGG - Intergenic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171573348 20:26274729-26274751 CTTGGGAGGCTGAGGTAGGAGGG + Intergenic
1171963281 20:31510722-31510744 CTCGGGAGGCTGAAGTGGGAGGG + Intergenic
1172008673 20:31834003-31834025 CTGGGGAGGTGCTAGCAGGATGG - Exonic
1172039751 20:32035475-32035497 CAGGGGAGCTTGAAGGAGCATGG + Intergenic
1172052094 20:32125774-32125796 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1172084605 20:32371027-32371049 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1172234740 20:33363788-33363810 CTCCGGAGGCTGAAGCAGGAGGG + Intronic
1172638036 20:36423065-36423087 ATGGGGGGCTTGAATGAGGACGG - Intronic
1172642375 20:36448240-36448262 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172785781 20:37467691-37467713 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1173058757 20:39641852-39641874 CTGGGGAGGCTGAGGTGGGAGGG - Intergenic
1173248321 20:41351143-41351165 CTGAGGAGGCTGAGGCAGGAGGG + Intronic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173492839 20:43497281-43497303 CTTGGGAGGCTGGAGCAGGAGGG + Intergenic
1173494585 20:43509330-43509352 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173791826 20:45833032-45833054 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1173823866 20:46035160-46035182 ATGGGGAGGCTCAAGGAAGAAGG - Intronic
1173901969 20:46596943-46596965 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1173911733 20:46675687-46675709 CTGGGGAGGCTGAGGCGGGAAGG - Intronic
1173911887 20:46676692-46676714 CTGGGGAGGCTGAGGCGGGAAGG - Intronic
1174000069 20:47368108-47368130 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1174012178 20:47458787-47458809 CTCAGGAGGCTGAAGCAGGATGG + Intergenic
1174022594 20:47542852-47542874 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174488787 20:50877614-50877636 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174589751 20:51635627-51635649 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1174798695 20:53544158-53544180 CTCGGGAGGCTGAGGTAGGAGGG + Intergenic
1174828214 20:53788447-53788469 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1174870143 20:54174110-54174132 GAGGGGGGGTGGAAGGAGGATGG + Intergenic
1175072259 20:56344388-56344410 TTGGGGAAGTTAAGGGAGGATGG - Intergenic
1175135209 20:56818349-56818371 CTGGGGAGGTGACAGGAGGGAGG + Intergenic
1175220254 20:57412558-57412580 AAGGTGAGGTTCAAGGAGGATGG - Intergenic
1175220676 20:57414761-57414783 GTGGGGAGACTGAAGCAGGAGGG - Intergenic
1175521879 20:59607039-59607061 CTTGGGAACTTGATGGAGGAAGG + Intronic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175683209 20:61006415-61006437 CTGGGTAGATTTAAGGATGAGGG + Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176015766 20:62931046-62931068 CTCGGGAGGGTGAGGCAGGAGGG - Intronic
1176099117 20:63356953-63356975 GTGGGGATGTGGAAGGAGGTGGG - Intronic
1176139479 20:63538697-63538719 TTGGGGAGGATGCAGGGGGAGGG + Intergenic
1176155612 20:63618673-63618695 CTGGGGAGGAAGAATAAGGATGG + Intronic
1176249480 20:64113474-64113496 GTGGGAAGGTTGGAGGAGAAAGG + Intergenic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177143974 21:17387902-17387924 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178170633 21:30035764-30035786 CTGGGGGGGTAGGGGGAGGAAGG + Intergenic
1178199831 21:30390911-30390933 GTGGGGAGCTAGAAGGGGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178277779 21:31254586-31254608 CTCGGGAGGTTGAGGCAGGTGGG + Intronic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178478330 21:32956963-32956985 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1178831217 21:36058391-36058413 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1178855042 21:36243778-36243800 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1178882480 21:36460453-36460475 GTGGGGACGTTGGAGGAAGACGG - Intergenic
1178945770 21:36946482-36946504 TTTGGGAGGTTGAGGCAGGAGGG - Intronic
1178950808 21:36983941-36983963 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179276206 21:39893940-39893962 TTCAGGCGGTTGAAGGAGGAAGG + Intronic
1179367206 21:40769542-40769564 CAGGGATGGTTGAAGGAGGCTGG - Intronic
1179404771 21:41116227-41116249 CTCGGGAGGCTGAGGTAGGAGGG + Intergenic
1179524022 21:41964079-41964101 CTGGGGAGATTTAGAGAGGAAGG - Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179904944 21:44418021-44418043 CTGAGGAGGATGAAGGGGGGCGG - Exonic
1180216944 21:46330223-46330245 CTAGGGAGGCTGAGGCAGGAGGG - Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1180969891 22:19809880-19809902 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181104153 22:20562926-20562948 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1181331746 22:22098274-22098296 CTGAGGAGGATGAAGGAGAGAGG - Intergenic
1181460437 22:23083043-23083065 GTTGGGAGAGTGAAGGAGGAGGG + Intronic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181774476 22:25149561-25149583 TTGGGGAGGGGCAAGGAGGAAGG - Intronic
1181971198 22:26691365-26691387 CTGGGTAGGTTGGAGGAGGATGG + Intergenic
1182098263 22:27640195-27640217 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1182122307 22:27796109-27796131 CTGTGGGGGTTGCAGGAGGCAGG - Intronic
1182139276 22:27938831-27938853 CTGAAGAGGTTGAGGCAGGAGGG + Intergenic
1182207444 22:28643212-28643234 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1182228710 22:28820160-28820182 CTTGGGAGGCTGAAGTGGGATGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182387162 22:29954187-29954209 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1182401936 22:30085036-30085058 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1182474218 22:30567519-30567541 TTGGGGAGGCTGAGGCAGGAGGG - Intronic
1182521752 22:30888618-30888640 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1182580599 22:31307706-31307728 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1182655761 22:31888655-31888677 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1182681793 22:32085227-32085249 CTCAGGAGGCTGAAGCAGGAAGG - Intronic
1182900337 22:33893274-33893296 CTGGGGTGGTGGGAAGAGGAAGG - Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183107136 22:35622715-35622737 CTGGGGAGGGTGGAGGGGGGAGG - Intronic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1183409858 22:37648452-37648474 TGGGGGAGGTGGCAGGAGGAAGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183701387 22:39453225-39453247 GTGGGGAGGGTGAGGGAGGTGGG - Intergenic
1183759569 22:39803917-39803939 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1183880871 22:40827745-40827767 TTTGGGAGGTTGAGGGAGGCAGG - Intronic
1184041713 22:41947875-41947897 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1184125873 22:42486651-42486673 CTTGGGAGGCTGAAGCAGGATGG + Intergenic
1184145738 22:42609252-42609274 TTTGGGAGGGCGAAGGAGGAAGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184392356 22:44211793-44211815 CTGGGAAGGTTAGAGCAGGATGG - Intronic
1184509327 22:44923901-44923923 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1184517935 22:44974304-44974326 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1184530440 22:45051945-45051967 CTGAGGAGGTTGAAGGAGGCTGG - Intergenic
1185149156 22:49154256-49154278 CTGGGGAGGGTGAAGAGGGTGGG + Intergenic
1185199379 22:49492206-49492228 CTGGGGAGGTAGGAGGAGGGCGG - Intronic
1185265160 22:49898106-49898128 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
949330847 3:2920296-2920318 GAGGGGAGGTAGAAGGAGGCTGG + Intronic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949477773 3:4465365-4465387 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
949569708 3:5281227-5281249 CTCGGGAGGCTGAAGTGGGAGGG - Intergenic
949706726 3:6826934-6826956 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
950037127 3:9894626-9894648 CTTGGGAGGTTGAGGCAGAATGG - Intergenic
950150573 3:10683902-10683924 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950215367 3:11154721-11154743 CTGGGGAGGGTGGCGGAGGGCGG + Intronic
950286371 3:11748484-11748506 CTTGGGAGGGTGAGGTAGGAGGG - Intergenic
950538716 3:13597172-13597194 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
950773205 3:15328630-15328652 CTGGGGAGGATGATGCAGGAGGG + Intronic
951512600 3:23520748-23520770 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
951514196 3:23540169-23540191 CTCGGGAGGCTGAAGCAGGAGGG - Intronic
951521660 3:23616205-23616227 CTGGGGAGGTTGAGGCTGCAGGG - Intergenic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
952014768 3:28943219-28943241 CTTCCGAAGTTGAAGGAGGAAGG - Intergenic
952266656 3:31793504-31793526 CTGTGTAGGTTTAAGGAGGATGG + Intronic
952311356 3:32193315-32193337 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
952757227 3:36881342-36881364 CTGGGGAGGCTGAGGCAGAATGG + Intronic
952798258 3:37262396-37262418 CTCGGGAGGCTGAATGAGGCAGG + Intronic
952832484 3:37576709-37576731 CTCGGGAGGCTGAGGGAGGATGG - Intronic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
952996728 3:38890196-38890218 GTGGGGAGGATTAAGGAAGAAGG + Intronic
953061258 3:39430188-39430210 GTGGGGAGGCTGTAGGAGGCCGG + Intergenic
953133529 3:40163304-40163326 CTGTGGAGGTCACAGGAGGAAGG - Intronic
953730808 3:45445964-45445986 CTGGGGAGGCTGAGGAGGGAGGG + Intronic
953837865 3:46362711-46362733 CTGTGGAGGATGGAGCAGGAGGG - Intergenic
953861772 3:46550497-46550519 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954023632 3:47764276-47764298 CTTGGGAGACTGAAGTAGGAGGG - Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954311401 3:49771009-49771031 CTAGGGAGGCTGAGGCAGGAGGG + Intronic
954318906 3:49817563-49817585 CTGAGGAGGCTGAGGTAGGAGGG + Intergenic
954363498 3:50134545-50134567 GTGGGAAGGGTGAGGGAGGAGGG + Intergenic
954485269 3:50844321-50844343 CTCAGGAGGCTGAGGGAGGACGG - Intronic
954619242 3:51986268-51986290 GTGAGGAGGCTGAAGGTGGAGGG + Exonic
954633489 3:52059152-52059174 CCGGGCAGGTTGGAGGAGGTTGG + Intergenic
954762558 3:52887263-52887285 CTTGGGAGGTGGAAGGAGGCTGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955016051 3:55070395-55070417 ATGGGGTGGTTGCAGGAGGGAGG + Intronic
955058304 3:55474862-55474884 GTGGGGAGGTAGAAGGTGGGGGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955171281 3:56567795-56567817 CTGGGGAGGCTGAGGCAGAATGG - Intronic
955325480 3:58006866-58006888 GTGGGGAGGTTGAAGCTGCAGGG + Intergenic
956089373 3:65649272-65649294 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
956162709 3:66371852-66371874 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
956356987 3:68404687-68404709 CTTGGGAGGCTGAGGAAGGAGGG + Intronic
956665058 3:71634179-71634201 CTTGGGAGGCTGAGGCAGGACGG - Intergenic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956970339 3:74516337-74516359 CTGGGGAGGAAGAAGAAGAAGGG - Intronic
957050867 3:75410887-75410909 CGGGGGAGGTGAAAGCAGGAGGG + Intergenic
957060839 3:75480148-75480170 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
957766859 3:84636761-84636783 CTGGTGAGGATGCAGGAAGAAGG - Intergenic
957870506 3:86085065-86085087 CTGGGGTGGATTAAAGAGGAGGG + Intergenic
958049264 3:88323655-88323677 CTGTGAAGGTTGAAGGTGAATGG + Intergenic
958440454 3:94150031-94150053 CTGGAGAGGTCCAAGGAGCAAGG + Intergenic
958459774 3:94379953-94379975 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
959968188 3:112379923-112379945 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
960051371 3:113241951-113241973 AGAGGGAGGTTGAGGGAGGAAGG + Intronic
960653015 3:119972541-119972563 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
960878717 3:122323111-122323133 CTGGGGAGATTCAATAAGGATGG + Intergenic
960915427 3:122689723-122689745 CTGGTCAGGTTTAAGGAGAAGGG - Intronic
960928755 3:122822954-122822976 GTGGGGAGGTGGAGGGCGGATGG - Intronic
961014513 3:123457290-123457312 CCTGGGAGCTAGAAGGAGGAGGG + Intergenic
961080621 3:124024297-124024319 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
961225822 3:125244891-125244913 TTGGAGAGGTTGAAGGAGTATGG - Intronic
961266772 3:125649318-125649340 CTTAGGAGGCTGAAGAAGGAGGG + Intergenic
961292544 3:125859257-125859279 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
961748027 3:129078330-129078352 TTGGGGAGGCTGAGGAAGGAGGG - Intergenic
961816991 3:129556174-129556196 CTGGGGCGGGGGCAGGAGGAGGG - Exonic
961883152 3:130077322-130077344 CGGGGGAGGTGAAAGCAGGAGGG + Intergenic
961890940 3:130129836-130129858 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
961894639 3:130157120-130157142 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
961902936 3:130231990-130232012 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
961962852 3:130869734-130869756 CTGTGAAGGTTGAGAGAGGAGGG + Intronic
962035608 3:131648262-131648284 CTTGGGAGGCTGAAGGTGGGAGG + Intronic
962345651 3:134617427-134617449 CAGGGGAGGTAGAAGGAGAGAGG + Intronic
962799126 3:138874871-138874893 CTTGGGAGGCTGAGGTAGGAGGG + Intergenic
962914830 3:139891539-139891561 CTGGGCAGGTAGAAGGAAGGAGG + Intergenic
963149647 3:142032209-142032231 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963762202 3:149295276-149295298 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
964019361 3:151989629-151989651 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
964049672 3:152375080-152375102 CTTGGGAGGCTGAAGAAGGAAGG - Intronic
964136577 3:153351532-153351554 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
964868390 3:161287051-161287073 CTGGTGAGGTTGTAGGAAAAAGG + Intergenic
965493272 3:169366202-169366224 CTGGGGAGATTCCAGGAAGATGG + Intronic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
966162426 3:176982794-176982816 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
966191541 3:177276261-177276283 CTGGTGAGGGTGAAGAATGATGG + Intergenic
966411135 3:179647079-179647101 CTGAGGAGGCTGAGGTAGGAAGG + Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966698076 3:182813833-182813855 CTCGGGAGGCTGACGCAGGAGGG - Intronic
966740790 3:183231560-183231582 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
966770460 3:183499236-183499258 CTCGGGAGGGTGAGGCAGGAGGG + Intronic
966774428 3:183531552-183531574 CTTGGGAGGCTGGAGGAGAATGG - Intronic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
966931229 3:184677112-184677134 AAGGGGAAGTTGCAGGAGGAAGG + Intronic
967019740 3:185512420-185512442 CTGGGGAGGTGGAAGAACCATGG + Intronic
967290477 3:187914925-187914947 GTTGGAAGGTTGAAGGAAGAGGG + Intergenic
967468068 3:189830791-189830813 TTTGGGACTTTGAAGGAGGAAGG + Intronic
967814934 3:193790549-193790571 CTGGGGAGGTGGAAGAAGTGGGG + Intergenic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
967981501 3:195068686-195068708 CTTGGGAGGCTGAAGTGGGAGGG - Exonic
968596611 4:1489338-1489360 CTGGGGAGGTGGGAGGCGGCAGG - Intergenic
968641994 4:1719684-1719706 CTGGGGAGGGTGCAGCTGGAAGG + Intronic
968650533 4:1758561-1758583 CTGGGCAGGTGGATGGAGGTGGG + Intergenic
968689859 4:1984825-1984847 CTGGGGATGTAGGAGGAGGCGGG + Exonic
969004741 4:4010203-4010225 CTCAGGAGGTTGAAGCAGGAGGG - Intergenic
969344147 4:6560858-6560880 TTGGGGAGGTGGCAGGAGGCAGG - Intronic
969351651 4:6601552-6601574 CTGGTGAGGTGGAAGCAGGGAGG + Intronic
969444739 4:7238270-7238292 CTGGGGAGGTAGAGGGAGTCTGG + Intronic
969637347 4:8377008-8377030 CATGGAAGGTGGAAGGAGGAAGG - Intronic
969751678 4:9116259-9116281 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
969809156 4:9634487-9634509 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
969811591 4:9652558-9652580 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970239803 4:13996737-13996759 CTCAGGAGGTTGAGGCAGGAGGG - Intergenic
970647793 4:18142658-18142680 CTGGGGAAGTTGAAGTGGGTGGG - Intergenic
971260705 4:25054342-25054364 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
971267102 4:25105499-25105521 AGGGGGAGGCTGAAGGAGGCAGG - Intergenic
971312121 4:25534293-25534315 CTCGGGAGGCTGAAGCAGGGAGG + Intergenic
971434524 4:26606089-26606111 CTGGGGAGGCTGAAGCCAGAGGG - Intronic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
971594363 4:28509851-28509873 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
971611288 4:28730359-28730381 CTAGGGAGGGTGTAGGTGGAAGG - Intergenic
972258897 4:37388289-37388311 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
972389207 4:38597282-38597304 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
972506598 4:39725748-39725770 CTCAGGAGGCTGAAGCAGGAGGG - Intronic
972649088 4:40998910-40998932 CTGGGCGGGATGAAGCAGGATGG + Intronic
972671651 4:41217751-41217773 CTGGGGAGGCTGAGGCAAGAGGG + Intergenic
972718797 4:41675434-41675456 GTGGGGAAGTTGACGGGGGATGG - Intronic
972792254 4:42384280-42384302 CTTGGGAGGCTGAGGGAGTAAGG - Intergenic
973198584 4:47474248-47474270 CTGGGGAGGCTGAGGTGGGAGGG + Intergenic
973236162 4:47908314-47908336 CTTGGGAGGCTAAAGCAGGAGGG + Intronic
973312430 4:48724018-48724040 CTTGGGAGGTTGAGACAGGAGGG + Intronic
973721110 4:53724532-53724554 GTGGGGAGGAGGAAGGAGGGAGG - Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
974083372 4:57235057-57235079 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
974169302 4:58245561-58245583 ATGGGGAGCTTAAAGGGGGATGG - Intergenic
974323058 4:60377119-60377141 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
974444722 4:61965103-61965125 CTTGGGAGGCTGAAGAGGGAGGG - Intronic
974504906 4:62757137-62757159 CTTGGGAGGTTGAGGCAGGAGGG + Intergenic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
975460767 4:74650976-74650998 CTCAGGAGGCTGAGGGAGGATGG + Intergenic
975572262 4:75829960-75829982 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
975713247 4:77181262-77181284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
976334960 4:83874774-83874796 CTGGGGTGTTACAAGGAGGAGGG + Intergenic
976656687 4:87496328-87496350 CTGGGGAGGCTGAAGTGGAAGGG - Intronic
976744929 4:88392930-88392952 CTGGGGAGGTTGAGGCAAGGGGG - Intronic
976767113 4:88609173-88609195 CTTGGGAGGTTGAGGTTGGAAGG + Intronic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977818376 4:101442712-101442734 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978380254 4:108120137-108120159 CTTGGGAGGTTGAGGCAGGAGGG - Intronic
978417375 4:108490773-108490795 CTGGGGAGGGTGGAGGTGGGTGG + Intergenic
978528223 4:109687985-109688007 CGTGGGAGGTTGAGGCAGGAGGG - Exonic
978613021 4:110565568-110565590 CTTGGGAGGTTGAGGCAGGAGGG - Intergenic
979000113 4:115206833-115206855 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
979109931 4:116740143-116740165 CTAGGGAGTTTGGAGCAGGAGGG + Intergenic
979111253 4:116761085-116761107 CAGGAGAGGTGGAAGGAGTAGGG - Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
979442607 4:120769338-120769360 CTGAGGAGGGTAAAGGAGCATGG + Intronic
980585584 4:134810605-134810627 TTGGGGAGCCTGAAGCAGGAGGG - Intergenic
980721376 4:136700025-136700047 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
981130693 4:141155484-141155506 GTGGGCACTTTGAAGGAGGAAGG + Intronic
981302499 4:143204495-143204517 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
981601380 4:146492473-146492495 CTTGGGAGCTTGAAGTGGGAGGG - Intronic
981641876 4:146953673-146953695 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982025360 4:151248204-151248226 CTCAGGAGGTTGAGGCAGGAGGG - Intronic
982235008 4:153243924-153243946 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982561261 4:156930758-156930780 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
982665375 4:158254513-158254535 CTGGGGCGGCTGAAGTAGGAGGG + Exonic
982943569 4:161589558-161589580 CTTGGGTGGCTGAAGCAGGAGGG - Intronic
982979336 4:162112348-162112370 CTGGGGAGGCTGAGACAGGAGGG - Intronic
983512269 4:168621491-168621513 CTGGGGTGGTGGAAGGAGTAAGG - Intronic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
984236539 4:177165544-177165566 CTGGGGAAGCTGCAGGAGTATGG + Intergenic
984251951 4:177346272-177346294 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
984553886 4:181191663-181191685 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984768030 4:183414355-183414377 TTTGGGAGGTTGAGGCAGGAGGG + Intergenic
984792469 4:183627274-183627296 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
984804855 4:183742669-183742691 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
985234109 4:187853901-187853923 CTGGGGAGGTTGAGGCTGCAGGG - Intergenic
985252325 4:188036374-188036396 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986226748 5:5823106-5823128 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986555780 5:9008693-9008715 CTGCTAAGGGTGAAGGAGGAGGG + Intergenic
986788759 5:11140250-11140272 CTGGACAGGTTGAAGGAGGCAGG - Intronic
986841987 5:11708152-11708174 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
986991494 5:13558204-13558226 CTGGGAAGGGTGGAGGAGGTGGG - Intergenic
987026768 5:13934774-13934796 CTGGGGAGGTGGCAAGAGGCAGG + Intronic
987062812 5:14258660-14258682 CTGGGGAGGTAGAAGGTGAGAGG - Intronic
987071294 5:14339127-14339149 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988351053 5:30107462-30107484 CTTGGGAGACTGAAGTAGGATGG + Intergenic
988394261 5:30677614-30677636 CTGAGGAGGCTGAAGGGGGGAGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988569459 5:32349991-32350013 CTCGGGAGGCTGAAGCAGAATGG + Intergenic
988582103 5:32477374-32477396 CTGGGGAGGCTGAGGCAGGACGG - Intergenic
988606920 5:32686518-32686540 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
988964713 5:36404392-36404414 CTAGGGAAGTGGAAGGAGTAGGG - Intergenic
989638160 5:43557300-43557322 CTGGGGGGGATGAGGGATGAGGG + Intronic
989705707 5:44327813-44327835 CTGGTGATGATGAAAGAGGAAGG - Intronic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
989791331 5:45405513-45405535 CTCAGGAGGTTGAAGCAGGAGGG - Intronic
990089686 5:52026765-52026787 CTGGTGAGGTTGCAGGAAAAAGG + Intronic
990303739 5:54474824-54474846 CAGGGGAGGTTGAAGAAAGATGG - Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
990480517 5:56206081-56206103 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
990671087 5:58130783-58130805 CTGGTGGGGATGAAGGAGCAGGG - Intergenic
991250266 5:64552817-64552839 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
991900017 5:71451368-71451390 CTGGGGAGGATGAGTGAGGCAGG + Intergenic
992017409 5:72589770-72589792 CTGGGGAGTTGGAAGGAGTTGGG + Intergenic
992103572 5:73431075-73431097 CTCGGGAGGCTGAGGCAGGATGG + Intergenic
992212327 5:74493073-74493095 CTGTGGAGGTTCTTGGAGGATGG - Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992402983 5:76428297-76428319 CTGGGAAGGGAGAAGGAGTAGGG + Intronic
992524678 5:77597012-77597034 CTTGGGAGGCTAAAGGCGGAAGG + Intronic
992732278 5:79683810-79683832 CTTGGGAGGCTGAGGGAGGCAGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993478711 5:88396684-88396706 TTGGTGTGGTTGAAAGAGGAAGG + Intergenic
993858701 5:93107450-93107472 CTGGGGTGGGGGCAGGAGGATGG - Intergenic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
994139582 5:96326953-96326975 CTGGAACGGTTGAAGGGGGATGG + Intergenic
994197335 5:96935461-96935483 CTGGGGAGGTTGGCCGCGGAGGG - Exonic
994450216 5:99931442-99931464 CTCGGGAGGCTGAAGCAGAATGG - Intergenic
994566301 5:101449931-101449953 CTTGAGAGGTGGAGGGAGGAGGG + Intergenic
994639563 5:102389984-102390006 TTGGGGAGGCTGAGTGAGGAGGG - Intronic
995100337 5:108292981-108293003 CTGGGGAGGCTGAGGCAGAATGG + Intronic
995231044 5:109763907-109763929 CTAGGGAGGCTGAGGCAGGAGGG - Intronic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995490916 5:112690973-112690995 ATGGGGTGGTTGTAGGGGGATGG + Intergenic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
995506548 5:112866452-112866474 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
995519346 5:112986893-112986915 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
996092228 5:119362551-119362573 TTTGAGAGGTTGAAGGAGGTGGG + Intronic
996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG + Intergenic
996215279 5:120858427-120858449 GTTGGGAGGTGGAAGGAGGGAGG + Intergenic
996434924 5:123423383-123423405 CAGGGGAGGTTGGAGGACAACGG + Intronic
996691558 5:126345856-126345878 CTGGGGAAGTTGAGGTAGAATGG - Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
997107647 5:131039004-131039026 CTGGGGAGGTTGACTGGGAAAGG + Intergenic
997267535 5:132503950-132503972 CTGGGGAGACTGGAGTAGGAGGG + Intergenic
997382810 5:133449615-133449637 CTGGGGTGGTTGCTTGAGGAAGG - Intronic
997398031 5:133580275-133580297 TTGGGGAGGGTCAAGGAGGTGGG - Intronic
997398133 5:133580900-133580922 CTGTGCAGATTGAAGGAGGCGGG - Intronic
997613273 5:135229939-135229961 CAGGGCAGGATGAGGGAGGAAGG - Intronic
997621924 5:135304676-135304698 TTGGGGAGATTGAGGGAGGGAGG + Intronic
997704429 5:135933749-135933771 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
997876265 5:137550371-137550393 GTGGGGTGGGGGAAGGAGGAGGG + Intronic
999161990 5:149509166-149509188 CTTGGTAGGCTGAAGGAGGGTGG - Intronic
999301872 5:150496269-150496291 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
999324432 5:150634711-150634733 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999721133 5:154400028-154400050 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000657264 5:163894787-163894809 CTGGGGAGGTTGAAGTGGGATGG + Intergenic
1000867956 5:166538429-166538451 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1000906878 5:166974929-166974951 CTGGGGAGGGGGGTGGAGGAGGG + Intergenic
1001209653 5:169798198-169798220 CCGAGGAAGTTGCAGGAGGAAGG - Intronic
1001295605 5:170496763-170496785 GTGGTGAGGTTGAGGGTGGACGG - Intronic
1001391759 5:171385313-171385335 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1001565353 5:172696330-172696352 CCCAGGAGGTTGTAGGAGGATGG - Intergenic
1001810434 5:174623486-174623508 CAGGGAAGGATGAAAGAGGAAGG - Intergenic
1001850465 5:174959988-174960010 CTGGTGAGGATGTAGGAGAAAGG - Intergenic
1001931033 5:175673088-175673110 CTGGTGAGGTAGAAGCAGGCAGG + Intronic
1001970327 5:175950145-175950167 CTTGAAAGGTGGAAGGAGGAGGG - Intronic
1001976896 5:176007411-176007433 CTGGGGAGGTTCAAGATGGGAGG + Intronic
1002061467 5:176628290-176628312 CTGGGGAGGAGGCAGGAGGGAGG + Intronic
1002065721 5:176650753-176650775 GTGGGGAGGTCGCAGGAGGTGGG + Intronic
1002338727 5:178500061-178500083 GTGGGGAGGTACAGGGAGGAAGG + Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002558872 5:180066727-180066749 CTAGGGAGGCTGAGGCAGGAAGG + Intronic
1002622751 5:180500540-180500562 CTCAGGAGGCTGAAGGAGAATGG - Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002862564 6:1093370-1093392 CTGGGGAGGTAGGTGGAGCAAGG - Intergenic
1002864686 6:1110543-1110565 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1002971757 6:2030049-2030071 GGGGGCAGGTTGGAGGAGGAGGG + Intronic
1003164058 6:3660941-3660963 CTGGGGAGAGTGAAGGACAAGGG - Intergenic
1003273687 6:4629706-4629728 CTGGGTGGCTTGTAGGAGGAAGG + Intergenic
1003283050 6:4710776-4710798 CTGGGAAGCTTTGAGGAGGAGGG - Intronic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003598813 6:7499977-7499999 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1003744830 6:8988826-8988848 CTTGGGAGGCTGAAGTAGGAAGG - Intergenic
1003938004 6:10995493-10995515 GTGGGGAGCTTGCAGGAGGCTGG - Intronic
1004196037 6:13506321-13506343 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1004226675 6:13791145-13791167 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004690882 6:17991038-17991060 CTTGGGAGGCTGAAGCAGGGGGG + Intergenic
1004707524 6:18138372-18138394 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004750771 6:18559744-18559766 CTCAGGAGGTTGAGGCAGGAGGG - Intergenic
1004957701 6:20748400-20748422 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1005027568 6:21478111-21478133 GAGGGGAGGCTGAAGAAGGATGG - Intergenic
1005055635 6:21726374-21726396 CTAGGGAGGCTGAGGCAGGAGGG - Intergenic
1005152499 6:22768194-22768216 CTCGGGAGGCTGAGGGCGGAGGG + Intergenic
1005303109 6:24490205-24490227 CTTGGGAGGTGGAAGGAAGGGGG + Intronic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1005934476 6:30509764-30509786 CTGGGGAGGCTGAAGTGGGTGGG - Intergenic
1006111241 6:31746925-31746947 CTCGGGAGGCTGAAGCAGAATGG - Intronic
1006149890 6:31981364-31981386 CTGGGGAGGCTGGTGAAGGAGGG + Exonic
1006156191 6:32014102-32014124 CTGGGGAGGCTGGTGAAGGAGGG + Intergenic
1006303329 6:33205377-33205399 CTGGGGAGGGAGTTGGAGGAGGG + Intronic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1006322814 6:33330371-33330393 TTGAGGAGGTTGTAGGAGCAAGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006487963 6:34360152-34360174 CTGGGGAGGTTGAAGCTGCAAGG + Intronic
1006511898 6:34526022-34526044 CCAGGGAGGGGGAAGGAGGAGGG + Intronic
1006514067 6:34536355-34536377 CTGGGGAGGTGTTTGGAGGAGGG + Intergenic
1006518467 6:34557427-34557449 CAGAGAAGGTTGAGGGAGGATGG + Intergenic
1006676141 6:35765010-35765032 CACGGGAGGTTGAGGCAGGAGGG + Intergenic
1006690691 6:35882422-35882444 CTTGGGAGGCTGAAGCAGCAGGG - Intronic
1006808443 6:36804561-36804583 GTGAGGTTGTTGAAGGAGGAGGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007279578 6:40700700-40700722 CTGGGCAGGTGCAAGGAGCAGGG + Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007577161 6:42932600-42932622 CTGGGGAGGGCGTGGGAGGAGGG + Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007671688 6:43559922-43559944 CTGGGGAGGCTTAAGGTGGGAGG - Intronic
1007694949 6:43726067-43726089 CTGGGGAGTTGGGAGGAGGGCGG - Intergenic
1007798503 6:44371189-44371211 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1008243388 6:49141448-49141470 CTCGTGAGGCTGAAGCAGGAGGG - Intergenic
1008541681 6:52551490-52551512 CAGGGGAGGGTGAATGAGGGAGG + Intronic
1008872770 6:56291311-56291333 CTGGGGTGTTTGAAGGGGCAAGG + Intronic
1008921740 6:56850117-56850139 AAGGGGAGGTGGAGGGAGGATGG - Intronic
1008974492 6:57408816-57408838 CTTGGGAGGTTGAGGCAGGAAGG - Intronic
1009163382 6:60310324-60310346 CTTGGGAGGTTGAGGCAGGAAGG - Intergenic
1009515384 6:64609639-64609661 TTTGGGAGGCTGAAGCAGGACGG + Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1009911241 6:69930708-69930730 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1009989721 6:70826820-70826842 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010037556 6:71343914-71343936 CTGTGAAGGGTAAAGGAGGAGGG + Intergenic
1010506129 6:76661757-76661779 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1010879067 6:81145548-81145570 CGGGGCTTGTTGAAGGAGGATGG - Intergenic
1011041721 6:83036839-83036861 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012122814 6:95388313-95388335 CTAGTGAGCTTGAAGGAGGCTGG + Intergenic
1012578818 6:100837723-100837745 CTGGGGAGATTGGGGGTGGAGGG + Intronic
1012579683 6:100851898-100851920 CCGGGGTGGTTGCAGGAAGATGG - Intronic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1012914101 6:105149836-105149858 CTGGGGAGGCTGAGGTGGGAGGG + Intergenic
1013085482 6:106853393-106853415 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1013136007 6:107283216-107283238 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1013249563 6:108320783-108320805 CTGGGGTGGTAGGATGAGGAAGG + Intronic
1013715290 6:112953455-112953477 CTGGGGAGATCGAAGAAGAAGGG + Intergenic
1014048370 6:116921713-116921735 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1014102243 6:117524307-117524329 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014235332 6:118948041-118948063 CTTGGGAGGCTGAAACAGGAGGG - Intergenic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1014671727 6:124312936-124312958 TTGGGCAGGTGCAAGGAGGATGG + Intronic
1014730095 6:125022426-125022448 CTGGGGAAGTTGGACTAGGAAGG + Intronic
1014753316 6:125276751-125276773 CTGGGGAGGTCTGAGGAGCAGGG - Intronic
1015023575 6:128506403-128506425 CTAGGTAGGTTGAGGGAGGTGGG - Intronic
1015803791 6:137088439-137088461 CTGGGGAGGCTGAGGTGGGAGGG + Intergenic
1015912173 6:138179915-138179937 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1016201781 6:141419039-141419061 CTGGGGAGGGTGGGGGAGCAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016274458 6:142332767-142332789 CTTGGGAGGATGAAGGCCGAAGG - Intronic
1016318764 6:142819124-142819146 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016676126 6:146770935-146770957 GAGGGGAGGTTGAAGTAGAATGG - Intronic
1017008201 6:150043424-150043446 CTGGGGAGGGGGCAGAAGGAAGG - Intergenic
1017061780 6:150491307-150491329 CTGGGGAGGGGAAGGGAGGAAGG - Intergenic
1017147364 6:151246867-151246889 CTCAGGAGGCTGAAGTAGGAGGG - Intronic
1017274925 6:152554871-152554893 CTTGGAAGGTTGCAGGATGAAGG - Intronic
1017441697 6:154470307-154470329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1017495514 6:154979725-154979747 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1017737871 6:157380749-157380771 CTGGGGAGGAGGAAGAAGGGAGG + Intergenic
1018131900 6:160739651-160739673 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1018754873 6:166840358-166840380 GTGGGGAGGTAGAGAGAGGAAGG - Intronic
1019302048 7:310435-310457 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1019332316 7:466533-466555 TGGAGGAGGGTGAAGGAGGAGGG - Intergenic
1019332377 7:466779-466801 GGGAGGAGGGTGAAGGAGGAGGG - Intergenic
1019500150 7:1360651-1360673 GTGGGGAGGCTGCAGCAGGAAGG + Intergenic
1019575914 7:1737584-1737606 CAGGGAACGTTGAAGGTGGAGGG - Intronic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019680566 7:2346336-2346358 CTGGGGAGGCCGAAACAGGAGGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1020152840 7:5696785-5696807 CTGGGAGGGCTGTAGGAGGACGG + Intronic
1020262057 7:6536261-6536283 CTGGGGAGGCTGCTGGAGGAAGG - Intronic
1020324871 7:6966698-6966720 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1020416782 7:7955445-7955467 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1020681189 7:11238827-11238849 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1021308633 7:19063484-19063506 TTGAGGAGGTGGAAGGAGGTGGG - Intronic
1021334313 7:19379885-19379907 ATAGGGAGATGGAAGGAGGAAGG - Intergenic
1021547986 7:21837561-21837583 CAGGGGAGGTAAAAGGAGGGAGG + Intronic
1022028446 7:26469659-26469681 TTTGGGAGGTTGAAGCAGGTGGG + Intergenic
1022241406 7:28516104-28516126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1022307868 7:29166136-29166158 CTTGGGAGGGTGAGGCAGGAGGG - Intronic
1022654322 7:32305159-32305181 ATGGGGAGGGTGATGGAGGCTGG - Intergenic
1022671330 7:32458961-32458983 CTGGGGTGGTTGTGGGGGGAGGG - Intergenic
1022728103 7:32998745-32998767 CCGGGGAGGGTGAAGCAGGCAGG + Intronic
1023402918 7:39803467-39803489 CTCGGGAGGCTGAGGTAGGAAGG - Intergenic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1023745949 7:43322552-43322574 CTGGGGAGGATGGAGAAGTAGGG - Intronic
1023750519 7:43367950-43367972 CTGGAGAGGTGGAAGCAGAAGGG - Intronic
1023764945 7:43501721-43501743 CTAGGGAGGCTGAAGCAGGAGGG + Intronic
1023861455 7:44219793-44219815 CTGGGTGGGTTGCAGGTGGATGG - Intronic
1024213717 7:47228777-47228799 GAAGGGAGGTTGCAGGAGGAGGG - Intergenic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1024263497 7:47589106-47589128 CTTGGGAGGCTGAAGCAGGTGGG + Intergenic
1024340889 7:48258029-48258051 CTAGGGAGGTTGAGGCAGGAGGG - Intronic
1024646714 7:51377175-51377197 CTCGGGAGGCTGAGGTAGGAAGG + Intergenic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025202109 7:56968803-56968825 CTTGGGAGGCTGAGGGGGGAGGG + Intergenic
1025206950 7:56999190-56999212 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1025664989 7:63577706-63577728 CTCGGGAGGCTGAGGCAGGAAGG - Intergenic
1025669838 7:63608125-63608147 CTTGGGAGGCTGAGGGGGGAGGG - Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1025825548 7:65007726-65007748 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025898554 7:65725538-65725560 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025977508 7:66380442-66380464 CTCGGGAAGCTGAAGTAGGAGGG + Intronic
1026109201 7:67445424-67445446 TTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026399819 7:69998287-69998309 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1026538550 7:71260700-71260722 CTTGGGAGGCTGACGCAGGAGGG - Intronic
1026633217 7:72057046-72057068 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1026780056 7:73260257-73260279 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1027020911 7:74813675-74813697 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1027067114 7:75132249-75132271 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1027148699 7:75716921-75716943 CTTGGGAGGTTGAGGTGGGAGGG - Intronic
1027239227 7:76316506-76316528 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1027585382 7:80050929-80050951 TTGGGGAGGCCGAAGCAGGAGGG + Intergenic
1027770302 7:82398683-82398705 CTCGGGAGGCTGAAGTGGGAGGG - Intronic
1028063473 7:86350747-86350769 CTCGGGAGGCTGAGGGAGAAAGG + Intergenic
1028159743 7:87472316-87472338 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028406125 7:90475849-90475871 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1028947827 7:96601004-96601026 CCAGGGATGTTGGAGGAGGAAGG + Intronic
1029369701 7:100141133-100141155 CTCGGGAGGCTGAGGCAGGAAGG - Intergenic
1029474718 7:100776208-100776230 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1029565786 7:101336804-101336826 CTCGGGAGGCTGAGGGAGGCAGG - Intergenic
1029591900 7:101512512-101512534 CTAGGGAGGCTGAGGCAGGAGGG + Intronic
1029626781 7:101724788-101724810 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1029910215 7:104137765-104137787 TTGGGGAGCCCGAAGGAGGATGG - Intronic
1030070529 7:105693976-105693998 CTGGGGTGGGGAAAGGAGGAGGG + Intronic
1030287141 7:107838291-107838313 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1030666774 7:112287265-112287287 CTTGGGAGGTTGAGGCAGGAGGG + Intronic
1030723072 7:112892662-112892684 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1031054026 7:116974397-116974419 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1031102918 7:117504644-117504666 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031953725 7:127920394-127920416 CTGCAGAGGTCGCAGGAGGATGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032103250 7:129001235-129001257 CTGGGGAGGTAGCAGGAATAGGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032578874 7:133084986-133085008 CTGGGGAGGCTGAACTGGGAGGG - Intergenic
1032610140 7:133403821-133403843 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
1032646071 7:133825250-133825272 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1032811715 7:135426104-135426126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1033217878 7:139506743-139506765 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1033261504 7:139848061-139848083 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1033737413 7:144236520-144236542 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1033745643 7:144314427-144314449 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1033768630 7:144523289-144523311 CTCGGGAGGCTGAAGTGGGAGGG - Intronic
1033796888 7:144856005-144856027 CTAGGGAGGCTGAGGCAGGAGGG - Intergenic
1033993620 7:147318332-147318354 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1034163497 7:149009036-149009058 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1034629643 7:152521212-152521234 AAGGGGAGGATGAGGGAGGATGG - Intergenic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1035241891 7:157537705-157537727 CTGGGGATGGTGGAGGATGAGGG - Intergenic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035430896 7:158820676-158820698 CTGGGGAGGCTGAGGCGGGAGGG + Intronic
1035438257 7:158875618-158875640 CTGGGGAGGCTGAAGCACCAAGG - Intronic
1035494582 7:159312196-159312218 CTGGGGAGGTTGAGGCTGCAGGG + Intergenic
1035572973 8:686050-686072 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035694996 8:1589510-1589532 CTGGGGAGGTTGAGGCTGCAGGG - Intronic
1036371194 8:8164247-8164269 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1036374890 8:8191690-8191712 CCGTGGAGGTTGAAGTGGGAGGG - Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1036799802 8:11781954-11781976 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1036854651 8:12231461-12231483 CTGTGGAGGTTGAAGTGGGAGGG + Intergenic
1036876012 8:12473954-12473976 CCGTGGAGGTTGAAGTGGGAGGG + Intergenic
1036879708 8:12501401-12501423 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1037147004 8:15584701-15584723 GTGGGGGTGGTGAAGGAGGAGGG + Intronic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1037380372 8:18278582-18278604 CTGGAGATCTTGAAGAAGGAGGG - Intergenic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037674706 8:21043276-21043298 GTGGGGTGGTGGAAGGTGGAGGG - Intergenic
1037763949 8:21760225-21760247 CTGGAGAGCATTAAGGAGGAAGG + Intronic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1038021174 8:23552846-23552868 TTGGGGAGGTTGGAGGGGTAGGG + Intronic
1038046628 8:23770992-23771014 ATGGGGAGGATGAAGGAAGGGGG + Intergenic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038150271 8:24937219-24937241 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1038219509 8:25594045-25594067 TTTGGGAGGTTGAGGCAGGAGGG - Intergenic
1038301173 8:26350506-26350528 CTGGGGAGGCTGAAGTGGGAAGG - Intronic
1038343970 8:26714998-26715020 CTGGGGAGGGTGAGGTGGGAGGG + Intergenic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038740113 8:30210001-30210023 CTAGGGAGGTTGAGGCAGGAGGG - Intergenic
1038797484 8:30722622-30722644 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1038821974 8:30960577-30960599 CTTGGGAGGTAGAGGAAGGATGG + Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039047934 8:33466995-33467017 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039567049 8:38559310-38559332 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1039963022 8:42264262-42264284 CTGGGGAGGCTGAGGTAGGAGGG - Intergenic
1041148819 8:54910575-54910597 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041268086 8:56084336-56084358 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1041411363 8:57560218-57560240 CTGGGGAGGCTGATGTAGAAGGG - Intergenic
1041770291 8:61465767-61465789 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1041899993 8:62971523-62971545 CTTGGGAGGTTGAAGTAGGAGGG + Intronic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042314543 8:67411603-67411625 CTGGGGATGGTGATGGAGGTGGG + Intergenic
1042603031 8:70518138-70518160 CTAGGGAGGGTGAGGCAGGAGGG - Intergenic
1042659408 8:71137115-71137137 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044074523 8:87802621-87802643 CTGGGTAGGATGGAGTAGGATGG + Intergenic
1044629767 8:94266990-94267012 CTGGGGAGGATGCAGCTGGAGGG - Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045133253 8:99182317-99182339 TTTGGGAGGATGAAGGAGGAAGG + Intronic
1045236996 8:100360785-100360807 GTGAGGAGGTTGAAGGAGGGGGG + Intronic
1045268132 8:100638060-100638082 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1045844662 8:106619874-106619896 CTGGGGAGGGGTAAGAAGGATGG - Intronic
1045847023 8:106649361-106649383 CTGTGGAGGTTGATTCAGGAAGG + Intronic
1045987299 8:108263478-108263500 CCAGTGAGGATGAAGGAGGATGG - Intronic
1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG + Intergenic
1046905707 8:119570306-119570328 TGGGGGAGGTTGAAGGGGGGTGG + Intronic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047020635 8:120771975-120771997 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1047235547 8:123039224-123039246 TGGAGGGGGTTGAAGGAGGAAGG - Intronic
1047406028 8:124586528-124586550 CTGGGGAGCTTGTAGGGGGAGGG - Intronic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047464679 8:125100801-125100823 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1047749216 8:127867253-127867275 CCTGGGAGGGTGGAGGAGGAGGG + Intergenic
1047803122 8:128330781-128330803 CTGGGGAGCTTGAGAGCGGATGG - Intergenic
1048041111 8:130729570-130729592 CTGGGGAGGGTAATGGTGGAGGG + Intergenic
1048086585 8:131187104-131187126 GTGGTGAGGTTGGGGGAGGAGGG + Intergenic
1048648699 8:136450945-136450967 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
1049069331 8:140344857-140344879 CCAGGGAGGTTGAAGCAGAAAGG + Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049283482 8:141762304-141762326 CTGGGGAGGGTGAGAGGGGAGGG + Intergenic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049879115 8:145050075-145050097 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1050233041 9:3548809-3548831 CTAGGGAGTATGCAGGAGGATGG + Intergenic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1051241085 9:15056677-15056699 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051518319 9:17955604-17955626 CTGGGTAGGACAAAGGAGGAAGG - Intergenic
1051875366 9:21787539-21787561 CCTGGGAGGTTGACGTAGGAAGG + Intergenic
1052211269 9:25906471-25906493 GTGGGTAGGTTGAATGAGAATGG - Intergenic
1052237462 9:26228940-26228962 TTGGGAAGGTTGAAGAAGAAAGG + Intergenic
1052335027 9:27310685-27310707 CAGGGGAGGTTAGAGGAGGTTGG - Intergenic
1052361930 9:27571561-27571583 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1052790829 9:32874137-32874159 CTGGGGAGGGGGAAGGAGAGTGG - Intergenic
1052793653 9:32902287-32902309 GTGGGGAGCTAGAAGGGGGATGG - Intergenic
1052993310 9:34535418-34535440 AGAGGGAGGTTGAAGGATGAAGG - Intergenic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053175661 9:35921203-35921225 CTCGGGAGGCTGAGGAAGGAGGG - Intergenic
1053336750 9:37281121-37281143 CTCAGGAGGCTGAAGCAGGAGGG - Intronic
1053377596 9:37621156-37621178 CTGAGGAGGATAAAGGAGGCAGG + Intronic
1053806110 9:41803629-41803651 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1054789546 9:69242969-69242991 CTGGGGAGGCTGAGGAGGGAAGG - Intronic
1054854552 9:69884592-69884614 CTCAGGAGGTTGAGGCAGGAGGG - Intronic
1054885661 9:70195591-70195613 CTGGGTAGGATGGAGAAGGATGG - Intronic
1054917694 9:70510809-70510831 CTTGGGAGGTTGAGGCAGGAAGG + Intergenic
1055022757 9:71687756-71687778 CTTGGAAGGCTGAAGTAGGAGGG + Intronic
1055115705 9:72602933-72602955 TTTGGGAGGTGGTAGGAGGAAGG + Intronic
1055131940 9:72785709-72785731 CTGGGCAGGGTGAAGTGGGAAGG + Intronic
1055238306 9:74151601-74151623 CTAGAGAAGTTGGAGGAGGAGGG + Intergenic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1055719483 9:79155895-79155917 CTGGGGAGGTTTAGAGAGGATGG - Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056165867 9:83940344-83940366 CTCGGGAGGTTGAGGTGGGAGGG + Intronic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056396870 9:86189204-86189226 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1056450745 9:86714433-86714455 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1056629353 9:88280397-88280419 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1056778652 9:89532971-89532993 CAAGGCAGGTGGAAGGAGGATGG + Intergenic
1056944211 9:90979763-90979785 ATTGTGAGGTTGAAGTAGGATGG - Intergenic
1057041777 9:91853333-91853355 CAGGTGAGGTGGAAGAAGGAGGG + Intronic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057722056 9:97540140-97540162 CTGGGAAGGTTGAAGGGAGATGG - Intronic
1057783397 9:98068703-98068725 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1057848611 9:98545817-98545839 CTGGGGAGCATGTAGGAGGCAGG - Intronic
1058571197 9:106346887-106346909 CTCGGGAGGGTGAGGTAGGAGGG + Intergenic
1058672416 9:107371153-107371175 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1058902497 9:109454215-109454237 CCAGGGAGGTGGAAGGAGGTGGG + Intronic
1059002518 9:110364978-110365000 TTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1059098956 9:111450818-111450840 CTTGGGAGGGTGAGGTAGGAGGG + Intronic
1059175267 9:112164437-112164459 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1059540538 9:115125941-115125963 CTGGGAAGGTTCTGGGAGGAGGG + Intergenic
1059749145 9:117231588-117231610 TTGGGGAGGATAAAGGGGGAAGG + Intronic
1060101411 9:120843687-120843709 CTCGGGAGGCTGAAGCGGGAGGG + Intergenic
1060199449 9:121644061-121644083 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1060281307 9:122217338-122217360 ATTGGGTGGTGGAAGGAGGAAGG - Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060395888 9:123316233-123316255 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060400039 9:123343197-123343219 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060502052 9:124165702-124165724 CTAGGGAGGCTGAGGCAGGAGGG + Intergenic
1060520591 9:124291960-124291982 CTGGGGTGGGTGCAGGAAGAAGG - Intronic
1060539985 9:124422869-124422891 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1060547318 9:124469085-124469107 CTGGGGAGGTCCAAGGAGCAGGG - Intronic
1060578416 9:124720157-124720179 CTTGGGAGGCTGATGGAGGCAGG - Intronic
1060580324 9:124739560-124739582 CTTGGGAGGCTGAAGTAGGAGGG - Intronic
1060680109 9:125554686-125554708 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1060795247 9:126508612-126508634 ATGGGAGGGTTGGAGGAGGAGGG - Intergenic
1060800372 9:126540814-126540836 CTCGGGAGGCTGAGGCAGGATGG + Intergenic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061081582 9:128374032-128374054 TTGGGGGGGTTGAAGGAAGATGG + Intronic
1061136724 9:128738787-128738809 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061344768 9:130014357-130014379 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1061382577 9:130267051-130267073 CTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1061416196 9:130448166-130448188 CTGCGGAGGCTGAGGGAGGGGGG + Intronic
1061595005 9:131623219-131623241 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061745817 9:132739649-132739671 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1061782508 9:133004273-133004295 GTGAGGTGGTTGGAGGAGGAGGG - Intergenic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1062107992 9:134766158-134766180 CTGGGAAGGCTGAAGGGGGCAGG - Intronic
1062447021 9:136599378-136599400 CAGGGGAGGTCCCAGGAGGAAGG + Intergenic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1062604647 9:137341071-137341093 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1203734228 Un_GL000216v2:120493-120515 CTGGGGAGGCTGAAGTGGGTTGG + Intergenic
1203734750 Un_GL000216v2:126090-126112 CTAGGGAGGCTGAAGCAAGATGG - Intergenic
1203489917 Un_GL000224v1:95002-95024 CTTGGGAGGTTGAGGCAGGAGGG + Intergenic
1203502540 Un_KI270741v1:36888-36910 CTTGGGAGGTTGAGGCAGGAGGG + Intergenic
1185553369 X:1001657-1001679 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185666319 X:1768199-1768221 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185735848 X:2495652-2495674 CAAGGGAGGAGGAAGGAGGAAGG - Intronic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186050721 X:5592085-5592107 CTGGGCAGGATGGAGCAGGATGG - Intergenic
1186086114 X:5992491-5992513 CTCGGGAGGTTGAGGTGGGAGGG + Intronic
1186343502 X:8667401-8667423 CTCTGGAGGCTGAAGCAGGAGGG - Intronic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1187318198 X:18217996-18218018 CTTGGGAGGCTGAGGTAGGATGG + Intronic
1187474654 X:19600274-19600296 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1187794012 X:22981305-22981327 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1187898220 X:24002734-24002756 CTGGGGAGTTTGAGGTGGGAGGG - Intronic
1188437561 X:30179662-30179684 ATGGGGAGCTTGAAAGGGGATGG - Intergenic
1188549668 X:31349332-31349354 CTAGGGAGGCTGAGGCAGGAGGG + Intronic
1189505108 X:41605489-41605511 CTTGGGTGGTTGAGGTAGGAGGG + Intronic
1189979930 X:46499268-46499290 CTCAGGAGGTTGAAGTAGGAGGG - Exonic
1190210337 X:48441871-48441893 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1190270168 X:48856776-48856798 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1190496646 X:51033412-51033434 CTGAGGAGTCTGAGGGAGGATGG - Intergenic
1190509326 X:51160525-51160547 CTGAGGAGTCTGAGGGAGGATGG + Intergenic
1190569375 X:51766173-51766195 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1190741103 X:53289321-53289343 CTGGGGAAGTTGGAGGAGAGAGG - Intronic
1190742561 X:53299507-53299529 GTGGGGGAGTTGAAGGAGGTTGG + Intronic
1190762890 X:53451280-53451302 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1190835257 X:54094787-54094809 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1191600830 X:63003903-63003925 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
1191741828 X:64444418-64444440 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192162186 X:68796747-68796769 GTGGAGAGGGTGAAGGAGTAAGG - Intergenic
1192173337 X:68870495-68870517 CTGGGAAGGTGGATGGAGGTTGG - Intergenic
1192408326 X:70909501-70909523 CTTGGGAGGTTGAGGCAGGAGGG + Intergenic
1192420693 X:71027480-71027502 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1192587626 X:72331930-72331952 TTAGGGATGGTGAAGGAGGAGGG - Intronic
1192814846 X:74579617-74579639 TTTGGGAGGTCGAAGCAGGAGGG - Intergenic
1193123656 X:77849182-77849204 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1193513114 X:82430675-82430697 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1193729512 X:85086194-85086216 GTGAAGAGATTGAAGGAGGAAGG - Intronic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194142999 X:90228418-90228440 CAAGGGAGCGTGAAGGAGGAGGG - Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1195164898 X:102209702-102209724 CTTGGGAGGCTGAGGAAGGAGGG + Intergenic
1195193960 X:102477389-102477411 CTTGGGAGGCTGAGGAAGGAGGG - Intergenic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195612712 X:106887068-106887090 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1195664433 X:107416042-107416064 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1195696219 X:107669582-107669604 TGGGGGAGGAGGAAGGAGGAAGG - Intergenic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1196187430 X:112759662-112759684 CTGGGCAGGATAAAGCAGGATGG - Intergenic
1196305548 X:114098176-114098198 CTGGGGAGGATGAAAAATGATGG + Intergenic
1196429493 X:115607608-115607630 CTCGGGAGGTTGAGTGAGGCAGG - Intronic
1196681014 X:118469618-118469640 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1196900307 X:120375858-120375880 CTCGGGAGGCTGAGGAAGGAGGG + Intronic
1197424230 X:126275151-126275173 TTGGGGAGGATGAAGAATGAAGG - Intergenic
1197448946 X:126587395-126587417 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1197695643 X:129547119-129547141 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1197775485 X:130116225-130116247 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1198314085 X:135449619-135449641 CTGGGGATGTTCCAGGAGAAGGG - Intergenic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199229290 X:145417327-145417349 TTGGGGAGGTTGAGGTGGGAAGG + Intergenic
1199514984 X:148665965-148665987 GTGGGGAGGGTGAAGCAGGATGG + Intronic
1199541511 X:148963009-148963031 TTGGGGATGTTGCAGGAGGAAGG + Intronic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199983006 X:152931362-152931384 CTTGGGAGGTTGAACCTGGAAGG - Intronic
1200087677 X:153616980-153617002 CTGGGGAGGCTGAGGTGGGAGGG - Intergenic
1200314036 X:155112370-155112392 CTGGGCAGGTTAGAGCAGGATGG + Intronic
1200427733 Y:3040015-3040037 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200488752 Y:3797737-3797759 CAAGGGAGCGTGAAGGAGGAGGG - Intergenic
1200806641 Y:7440362-7440384 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1200917188 Y:8581708-8581730 CTGGGTTGGTTGCAGGATGATGG - Intergenic
1201269310 Y:12239108-12239130 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic