ID: 1045040008

View in Genome Browser
Species Human (GRCh38)
Location 8:98214463-98214485
Sequence TCTCGTCAAAAATAATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045040008_1045040011 -10 Left 1045040008 8:98214463-98214485 CCAGGCTATTATTTTTGACGAGA 0: 1
1: 0
2: 2
3: 22
4: 269
Right 1045040011 8:98214476-98214498 TTTGACGAGATGGTATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045040008 Original CRISPR TCTCGTCAAAAATAATAGCC TGG (reversed) Intronic
900388647 1:2423346-2423368 TCTCTTTAAAAAAAATAGCTGGG - Intergenic
902897408 1:19488428-19488450 TCTCTACAAAAAAATTAGCCTGG - Intergenic
903586345 1:24418460-24418482 TCTCTACAAAAAAATTAGCCAGG + Intronic
903619893 1:24690346-24690368 TCTCTACAAAAAAATTAGCCAGG + Intergenic
904545032 1:31262839-31262861 TCTCTACAAAAAAATTAGCCAGG + Intronic
907022312 1:51080218-51080240 TCTCTACAAAAATAAAAGTCAGG - Intergenic
907037146 1:51226416-51226438 TCTCTACAAAAAAAATAGCTGGG + Intergenic
907339234 1:53722671-53722693 TCTCTACAAAAAAATTAGCCAGG + Intronic
907477713 1:54716680-54716702 CCTCATCAAAAATAATTGACTGG - Exonic
908278023 1:62497374-62497396 TCTAGTAAAATATAGTAGCCTGG - Intronic
908292942 1:62686937-62686959 TCTCTGCAAAAAAATTAGCCAGG - Intronic
908377225 1:63555902-63555924 TCTCTTTAAAAAAATTAGCCAGG - Intronic
909125054 1:71656991-71657013 TGGCTTCAAAAATAATAGCCAGG + Intronic
909574959 1:77164257-77164279 TCTCATCAAAAATGTTTGCCTGG - Intronic
911019373 1:93371762-93371784 TCTCCTAAAAAAAATTAGCCAGG - Intergenic
911320148 1:96403969-96403991 TCTATAAAAAAATAATAGCCAGG + Intergenic
912353856 1:109039734-109039756 TCTGTTCAAAAATAATATACAGG + Intronic
912784513 1:112587304-112587326 CCTTGTCAAAAATCATGGCCAGG + Intronic
914768967 1:150666503-150666525 TCTCCACAAAAAAATTAGCCAGG - Intronic
914853632 1:151333870-151333892 TCTCTACAAAAAAATTAGCCAGG - Intergenic
916190505 1:162173174-162173196 CCCCGTCAAAAATATTAGACGGG - Intronic
916657750 1:166892362-166892384 TCTAGTCAAAAATAATAGGCTGG - Intergenic
917106423 1:171496956-171496978 TCTCTACCAAAAAAATAGCCAGG - Intronic
917893064 1:179458148-179458170 TCTCTACAAAAAAATTAGCCAGG - Intronic
920709091 1:208278013-208278035 TCTAGTCAAAAAGAATAGCCAGG + Intergenic
921704246 1:218302487-218302509 TCTGGTCAAAAATAAGAAGCTGG + Exonic
922537368 1:226391126-226391148 TCTCTGCAAAAAAATTAGCCAGG - Intronic
1063208990 10:3861753-3861775 TGTTGTCAAAAATAATAACAAGG - Intergenic
1063476919 10:6336871-6336893 TCTCTGCAAAAAAATTAGCCAGG - Intergenic
1063805169 10:9630877-9630899 GCTCCTCAAAATTAATTGCCTGG + Intergenic
1063973072 10:11395039-11395061 TCTCATAAAAAGTAACAGCCCGG - Intergenic
1064019240 10:11796063-11796085 TCTCTGCAAAAAAATTAGCCGGG + Intergenic
1064159773 10:12935057-12935079 TCTCTTAAAAAAAAAAAGCCAGG - Intronic
1065005790 10:21378973-21378995 TCTCTACAAAAATATTAGCCAGG + Intergenic
1066365762 10:34775347-34775369 TCTCTGCAAAAAAACTAGCCAGG + Intronic
1067108245 10:43379877-43379899 TCTCTACAAAAAATATAGCCGGG - Intergenic
1068428534 10:56900483-56900505 TCTCTTCTAAAATAATGGCACGG + Intergenic
1068577830 10:58704651-58704673 TCTCTTGAATAATAATAGTCTGG - Intronic
1068990703 10:63147479-63147501 TCTCTACAAAAATACAAGCCGGG - Intronic
1069957120 10:72058982-72059004 TTTCGTGAAAAATAATACCAAGG + Intergenic
1070062785 10:73001254-73001276 TCTTTTCAAAAAAATTAGCCAGG - Intergenic
1070496975 10:77033582-77033604 TCTCATTAATAATAATAGCAAGG - Intronic
1071430927 10:85606106-85606128 TTTCTTCAGAAATAATAGACTGG - Intronic
1072479486 10:95796909-95796931 TCTCTACAAAAAAATTAGCCAGG + Intronic
1072571471 10:96661623-96661645 TCTACTCAAAAATATTAGCCAGG + Intronic
1073368877 10:102968766-102968788 TCTCTACAAAAAAATTAGCCTGG - Intronic
1075338435 10:121625927-121625949 TCTATTAAATAATAATAGCCGGG - Intergenic
1078370402 11:10739915-10739937 TCTCCACAAAAAAATTAGCCAGG + Intergenic
1079639473 11:22786186-22786208 TATTTTCAAAAATAAAAGCCTGG - Intronic
1082276125 11:50223403-50223425 TCTCTACAAAAAAATTAGCCAGG + Intergenic
1082913161 11:58400264-58400286 TCTTGTCAAAGATAATCTCCAGG + Intergenic
1088353098 11:108911727-108911749 TCTCTACAAAAAAATTAGCCAGG - Intronic
1088599360 11:111461551-111461573 TCTCTACAAAAATATTAGCCGGG + Intergenic
1089445191 11:118546328-118546350 TCTCTACAAAAAAATTAGCCGGG + Intronic
1089786573 11:120911543-120911565 TCTCTTTAAAGATAATAGGCTGG + Intronic
1090004547 11:122989992-122990014 TCTCTACAAAAAAATTAGCCAGG + Intergenic
1090524349 11:127514866-127514888 TCTAATAAAAAAAAATAGCCGGG + Intergenic
1092886934 12:12932860-12932882 TCTCTTAAAAAAAAATTGCCAGG + Intergenic
1093748947 12:22776667-22776689 TCTGGTTAATAATGATAGCCTGG - Intergenic
1093751524 12:22805518-22805540 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1094583918 12:31759327-31759349 TCTCTACAAAAAAATTAGCCTGG + Intergenic
1095433718 12:42164668-42164690 TCTCATCAAAAAAAAAAGGCTGG + Intronic
1095838560 12:46666240-46666262 TCTCTACAAAAAAAATAGCCGGG - Intergenic
1096912017 12:54993790-54993812 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1098896225 12:76064005-76064027 TCTCTACAAAAATAACAGCCAGG + Intronic
1101287113 12:103326283-103326305 GCTTGTCAAAGATAAAAGCCAGG + Intronic
1102971480 12:117171194-117171216 TCTCTACAAAAAAATTAGCCAGG + Intronic
1102996557 12:117355918-117355940 TCTCTACAAAAAAATTAGCCAGG - Intronic
1103303964 12:119949609-119949631 TCTCACCAAAAAAATTAGCCAGG + Intergenic
1103625150 12:122213079-122213101 TCTCTACAAAAAAATTAGCCAGG - Intronic
1104925493 12:132311930-132311952 AATCATCAAAATTAATAGCCAGG - Intronic
1106503139 13:30348302-30348324 TCTCTTCAAAAAAATTAGCCAGG - Intergenic
1106999182 13:35523752-35523774 TCTTTTCAAAAATATTTGCCAGG + Intronic
1107295674 13:38904850-38904872 TCTCTACAAAAATACTAGCTGGG + Intergenic
1107687589 13:42919332-42919354 TCTGTTCAAAAATAATAGAAGGG + Exonic
1112211563 13:97382817-97382839 TCTCTACAAAAAAATTAGCCAGG - Intronic
1115241193 14:31252453-31252475 TCTGTTCAAAAATAAGATCCAGG + Intergenic
1116818451 14:49604530-49604552 TCTCTACAAAAAAATTAGCCAGG + Intronic
1116825902 14:49673180-49673202 TCTTGGCATAAATGATAGCCTGG - Intronic
1119688590 14:76653002-76653024 TCTCGACAAAAAAATTAGCTGGG - Intergenic
1120623577 14:86796256-86796278 TCTCTTCAAAATTAATTGCTGGG - Intergenic
1120840010 14:89077477-89077499 TGTCTTCAAAAAAATTAGCCAGG - Intergenic
1120943926 14:89976264-89976286 TCTCTACAAAAAAATTAGCCAGG - Intronic
1125385617 15:39133412-39133434 TCTCAGCAACAAAAATAGCCGGG - Intergenic
1125629860 15:41138452-41138474 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1125780573 15:42262582-42262604 TCTCTACAAAAAAATTAGCCGGG - Intronic
1126107843 15:45158539-45158561 TCTCTACAAAAAAATTAGCCGGG + Intronic
1127083679 15:55405541-55405563 TCTCAAAAAAAGTAATAGCCAGG + Intronic
1127380645 15:58428168-58428190 TCTGGACAAATACAATAGCCAGG + Intronic
1128105126 15:65038580-65038602 TCTCTAAAAAAATATTAGCCAGG - Intergenic
1131679932 15:94710622-94710644 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1133316488 16:4887761-4887783 TATCTACAAAAATATTAGCCAGG - Intronic
1134113554 16:11531294-11531316 TCTCTACAAAAATAAAAGCCGGG + Intergenic
1135434794 16:22419673-22419695 TCTTGTAAAAAAAATTAGCCGGG - Intronic
1135747083 16:25026459-25026481 TCTCTACAAAAAAATTAGCCAGG + Intergenic
1136523535 16:30813390-30813412 TCTCTCCAAAAAAAAAAGCCGGG + Intergenic
1140230563 16:73114089-73114111 TCTCTTAAAAAAAAATGGCCGGG - Intergenic
1140845611 16:78884109-78884131 TCTCTACAAAAATATTAGTCAGG + Intronic
1141238764 16:82245011-82245033 TCTCTACAAAAAAATTAGCCAGG + Intergenic
1142043973 16:87913448-87913470 TCTTGTAAAAAAAATTAGCCGGG - Intronic
1143062602 17:4214991-4215013 TCTCTTTAAAAAGATTAGCCAGG + Intronic
1143812535 17:9483897-9483919 TTTAGGCAAAAATAAGAGCCTGG + Intronic
1146724299 17:35145212-35145234 TCTCTACAAAAAAAATAGCCAGG + Intergenic
1148609696 17:48956478-48956500 TCTCTACAAAAATATTAGCCCGG - Intergenic
1150760618 17:67957698-67957720 TCTCCTCAAAAAAATTAGCTGGG + Intronic
1151607574 17:75148926-75148948 ACTCATCATAAATAACAGCCTGG + Intronic
1153579715 18:6560674-6560696 TCTACTAAAAAAAAATAGCCAGG - Intronic
1153626179 18:7024138-7024160 TCTCATCAAGAACAATAGGCCGG - Intronic
1153627483 18:7035581-7035603 TCTCTCAAAAAATATTAGCCAGG - Intronic
1153907420 18:9674784-9674806 CCTCTTCAAAAATAATAGATGGG + Intergenic
1155259795 18:24030813-24030835 TCTCGGCTAAAAAATTAGCCGGG - Intronic
1155890837 18:31267051-31267073 TTTAGACAAAAATAATAGGCCGG + Intergenic
1157369075 18:47093676-47093698 TCTCTACAAAAAAATTAGCCAGG - Intronic
1159444356 18:68522382-68522404 TCTGGTCAAAAGTAAAAGCAGGG + Intergenic
1159646040 18:70919974-70919996 TCTCTACAAAAAAAAAAGCCAGG + Intergenic
1159932587 18:74329219-74329241 TCTCTACAAAATTATTAGCCAGG + Intronic
1160189215 18:76701242-76701264 TCTCTACAAAAAAATTAGCCAGG + Intergenic
1160211929 18:76888200-76888222 TCTCTGCAAAAAAATTAGCCGGG + Intronic
1160447924 18:78941639-78941661 TCTCTACAAAAAAATTAGCCTGG - Intergenic
1162202794 19:9033314-9033336 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1163146584 19:15383797-15383819 TCTAGTCAAAAATATCAGTCGGG - Intronic
1165201279 19:34146914-34146936 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1165383537 19:35497063-35497085 TCTTGTCAGAAATAAAACCCAGG + Intergenic
1165705631 19:37974350-37974372 TCTCTACAAAAAAATTAGCCAGG + Intronic
1165882865 19:39055862-39055884 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1167493473 19:49805065-49805087 TCTCTACAAAAAAATTAGCCAGG - Intronic
1167526108 19:49984790-49984812 TCTCTACAAAAAAAGTAGCCGGG - Intronic
924984952 2:262932-262954 TCTCCTCAAACATGATAGACAGG + Intronic
925249130 2:2415435-2415457 TTTCTGCAAAAATAATAGCTGGG - Intergenic
925545739 2:5014097-5014119 CCATGTCTAAAATAATAGCCAGG - Intergenic
925972469 2:9115706-9115728 TCTCTACAAAAACATTAGCCTGG - Intergenic
926030102 2:9579102-9579124 CCTCTACAAAAATACTAGCCAGG - Intergenic
927243851 2:20941312-20941334 TCTCTGCTAAAATAATAGCAAGG - Intergenic
927800415 2:26094054-26094076 TCTCTACAAAAAAATTAGCCAGG - Intronic
928545191 2:32322833-32322855 TCTCTACAAAAAAATTAGCCAGG + Intergenic
928552496 2:32386603-32386625 TCTACTAAAAAATAACAGCCAGG - Intronic
929159254 2:38815226-38815248 TCTCTACAAAAAAATTAGCCAGG - Intronic
930045652 2:47169448-47169470 TCTCCTCAAAAAAAATAGACTGG - Intronic
930255936 2:49091462-49091484 TCTCTACAAAAAATATAGCCAGG - Intronic
930420499 2:51146907-51146929 TCTCTTCAAAAATAACTACCAGG - Intergenic
932254570 2:70273253-70273275 TCTTCAGAAAAATAATAGCCTGG - Intronic
935826524 2:106956838-106956860 TCACATCAAAAATAATTACCAGG - Intergenic
936431950 2:112472434-112472456 TCTCTACAAAAAAATTAGCCAGG + Intergenic
938027079 2:127958943-127958965 TCTCTTTAAAAATATTAGCCGGG - Intronic
940588667 2:155690628-155690650 TCTGTCCAAAAATAATAGACCGG + Intergenic
941925303 2:170888346-170888368 TCTCTTTAAAAAAATTAGCCAGG + Intergenic
942376405 2:175342655-175342677 TCTCTACAAAAAAATTAGCCAGG - Intergenic
942547932 2:177084034-177084056 TCTCTCCAAAAAAAGTAGCCAGG - Intergenic
942624077 2:177880427-177880449 TCTTGTCACACATGATAGCCAGG + Intronic
942877507 2:180818976-180818998 TCTCTACAAAAAAATTAGCCAGG + Intergenic
943143552 2:184013836-184013858 TGTGGTCAAAAATAATATCTGGG - Intergenic
943243601 2:185419265-185419287 TCTCTACAAAAAAATTAGCCGGG - Intergenic
944942278 2:204641998-204642020 TCTCAGAAAAAAAAATAGCCTGG + Intronic
945693484 2:213072022-213072044 ATTGGTCAAAAATAATAGCTTGG + Intronic
945813872 2:214580027-214580049 TCTCTACAAAAAAATTAGCCAGG - Intergenic
946165606 2:217861946-217861968 TCTGCTCAAAAATCATGGCCTGG + Intronic
947185786 2:227454214-227454236 TCTCTTAAAAAAAAATAGCTGGG + Intergenic
1169379324 20:5093406-5093428 TCTCTACAAAAAAATTAGCCAGG - Intronic
1170130328 20:13012068-13012090 TCAGGTCAAAAATAATTGCTGGG - Intronic
1170733397 20:18993042-18993064 TCTCTACAAAAAAAATAGCCAGG - Intergenic
1170777152 20:19385800-19385822 TCTCTACAAAAATAAGATCCTGG - Intronic
1172464467 20:35145839-35145861 TCTCCACAAAAAAATTAGCCGGG + Intronic
1172544221 20:35746967-35746989 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1172779470 20:37427304-37427326 TCAAGTCTAAAATAATAGCTGGG + Intergenic
1173585139 20:44176632-44176654 TCTCTACAAAAAAATTAGCCAGG + Intronic
1173828275 20:46061421-46061443 TCTAGACAAAAACAAGAGCCTGG + Exonic
1175113698 20:56666773-56666795 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1175363796 20:58436492-58436514 TCTCTACAAAAAAATTAGCCAGG - Intronic
1178262584 21:31113805-31113827 TCTCTACAAAAAAATTAGCCGGG + Intergenic
1179183538 21:39065030-39065052 ACTCATCAAAAATAAAGGCCAGG + Intergenic
1179208240 21:39303660-39303682 TCTCTACAAAAAAAATAGCCAGG + Intronic
1179968541 21:44820342-44820364 TCTCCACAAAAAAATTAGCCGGG + Intergenic
1180637694 22:17273967-17273989 TCTCGAAAAAAAAAATAGCTGGG + Intergenic
1180792657 22:18584865-18584887 TCTCTACTAAAATATTAGCCAGG + Intergenic
1181229080 22:21410446-21410468 TCTCTACTAAAATATTAGCCAGG - Intergenic
1181249571 22:21524419-21524441 TCTCTACTAAAATATTAGCCAGG + Intergenic
1182341267 22:29623110-29623132 TTTCTTCAAAAAAATTAGCCAGG - Intronic
1182389295 22:29977977-29977999 TCTCTACAAAAATAGTAGCCAGG + Intronic
1183179027 22:36246074-36246096 ACTCTCCAAAACTAATAGCCAGG + Intergenic
949630310 3:5919302-5919324 TCTCTACAAAAAAATTAGCCGGG + Intergenic
950849538 3:16049835-16049857 TCTCTACAAAAAAAATAGCTGGG - Intergenic
953314220 3:41910800-41910822 TCTCTACAAAAAAATTAGCCAGG + Intronic
953715946 3:45317139-45317161 TCTCTACTAAAATATTAGCCAGG + Intergenic
953953234 3:47209141-47209163 TCTCTTCAAAAAAATTAGCTGGG + Intergenic
955360244 3:58267910-58267932 TCTCTACAAAAAAATTAGCCAGG + Intronic
958039178 3:88206088-88206110 TGTCTGCAAAAATATTAGCCGGG + Intergenic
958649261 3:96916552-96916574 TCTCTTCAAAACTATTAGACTGG - Intronic
958935038 3:100247628-100247650 TCTCTACAAAAAAATTAGCCAGG - Intergenic
960224581 3:115154787-115154809 TCTCGTCAAAAATTTCAGCCAGG + Intergenic
961492255 3:127264032-127264054 ACTCATTAAAAATAATTGCCTGG - Intergenic
961693748 3:128689473-128689495 TCTACTGAAAAAAAATAGCCAGG + Intergenic
961701353 3:128747288-128747310 TCTCTTAAAAAATAATCGGCCGG + Intronic
962505898 3:136046014-136046036 TCTCTACAAAAAAATTAGCCAGG + Intronic
963062725 3:141238037-141238059 TCCAGTCCAAAATAGTAGCCAGG - Intronic
963960894 3:151307679-151307701 ACTTGTCAAAAAGAATAGTCAGG - Intronic
964054028 3:152430180-152430202 TCTCGTCAAATAAAATACACTGG - Intronic
965531822 3:169778059-169778081 CCTCTACAAAAAAAATAGCCAGG + Intronic
966720500 3:183057709-183057731 TCTCTACAAAAAAACTAGCCAGG + Intronic
968775843 4:2539366-2539388 TCCTGTCAAAAATAATACTCAGG - Intronic
968906128 4:3451642-3451664 TCTCTACAAAAAAATTAGCCGGG + Intergenic
971747450 4:30602060-30602082 TCTCTTCAAAAATAACATACGGG + Intergenic
973018944 4:45175309-45175331 TCTCAGCAAAAATTGTAGCCTGG - Intergenic
973308454 4:48678686-48678708 TCTCTTCAAAAATAAAATTCAGG - Intronic
974030206 4:56769852-56769874 TCTCTACAAAAAAAATAGGCAGG + Intergenic
975149560 4:71005665-71005687 TCTAGTAAAAAAAATTAGCCAGG - Intronic
975568963 4:75792534-75792556 TCTCAAAAAAAATACTAGCCAGG + Intronic
976176950 4:82364135-82364157 TCTCTGCAAAAATATTAGCCGGG - Intronic
976712447 4:88086840-88086862 TCTCTACAAAAAAATTAGCCAGG + Intergenic
978191802 4:105922543-105922565 TCTCTACAAAAAAACTAGCCAGG - Intronic
978571619 4:110144085-110144107 TCTTGAGAAAAATAAAAGCCAGG + Intronic
980651042 4:135714699-135714721 TCTCTACTAAAAAAATAGCCGGG - Intergenic
982800801 4:159704793-159704815 TCTCTTCAAAGATAAGTGCCAGG + Intergenic
982842778 4:160213115-160213137 TGTCTTCAAAAATAATAACCTGG + Intergenic
983241422 4:165237490-165237512 TCTTGTCAAAGATAATCTCCAGG + Intronic
983848806 4:172553887-172553909 TCTCTACAAAAAAATTAGCCAGG + Intronic
984649034 4:182249921-182249943 TCTCTTAAAAAAAAGTAGCCAGG - Intronic
987603805 5:20107239-20107261 TCTCTACTAAAAAAATAGCCGGG - Intronic
988028614 5:25732626-25732648 TCTCCACAAAAAAATTAGCCGGG - Intergenic
991719150 5:69479626-69479648 TCTCTACAAAAAAATTAGCCAGG - Intergenic
992915466 5:81447656-81447678 TCTCGTCTGAAATAATTGGCAGG - Intronic
995152870 5:108870815-108870837 TGTCATCAAAATTATTAGCCTGG - Intronic
996226040 5:120997565-120997587 TTTTGTCAGAAATAATAGTCTGG - Intergenic
996947179 5:129084579-129084601 TCTATTCAAAAATTATGGCCAGG + Intergenic
997184510 5:131868248-131868270 TCTACTAAAAAATATTAGCCTGG - Intronic
997277838 5:132612665-132612687 TCTCTACAAAAAAATTAGCCAGG + Intronic
997516952 5:134496673-134496695 TCTCTACAAAAAAATTAGCCAGG + Intergenic
998195325 5:140064554-140064576 TCTCTACAAAAAAATTAGCCAGG + Intergenic
998545532 5:143024194-143024216 TCTCATCAAACAAAATAGCTGGG - Intronic
998708822 5:144797360-144797382 TCTCTGAAAAAAAAATAGCCAGG + Intergenic
1000849133 5:166318245-166318267 TCTCTTCAAATATAAGAGCTAGG - Intergenic
1002207392 5:177572905-177572927 TCTCTACAAAAAAATTAGCCGGG - Intergenic
1003832059 6:10022439-10022461 TCTCATGAAATATATTAGCCGGG + Intronic
1005612483 6:27539692-27539714 TCTCTACAAAAAAATTAGCCGGG - Intergenic
1005837975 6:29722359-29722381 TCTCTACAAAAAAATTAGCCGGG + Intergenic
1006353713 6:33540996-33541018 TCTCTTAAAAAAGAATAGGCTGG + Intergenic
1006607957 6:35272796-35272818 TCTCTACAAAAATAATTGCCAGG - Intronic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1006876362 6:37300655-37300677 ACTAATAAAAAATAATAGCCAGG - Intronic
1010572132 6:77489534-77489556 TATTGTCAAAAATGATAGACTGG + Intergenic
1011732161 6:90275806-90275828 TCTCTACAAAAAAATTAGCCAGG + Intronic
1012666409 6:101976526-101976548 TCTCTATAAAAATATTAGCCAGG + Intronic
1014089633 6:117389061-117389083 TCTAGTCAGAACAAATAGCCAGG - Intronic
1017165739 6:151406990-151407012 TCTCTACAAAAAAATTAGCCAGG + Intronic
1018436463 6:163763736-163763758 TTCCTTTAAAAATAATAGCCAGG + Intergenic
1020220186 7:6230441-6230463 ACTAGTCAAAAATAAAAACCTGG + Intronic
1021581688 7:22160898-22160920 TATCTTAAAAAATAATAGGCCGG + Intronic
1025088788 7:56045341-56045363 TCTCTGCAAAAAAATTAGCCAGG + Intronic
1026077299 7:67183986-67184008 TCTCGCTACAAAAAATAGCCAGG - Intronic
1026146394 7:67750234-67750256 ACTCTACAAAAAAAATAGCCAGG - Intergenic
1026191615 7:68133590-68133612 TCTCTACAAAAAAATTAGCCAGG + Intergenic
1026210899 7:68304054-68304076 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1026381722 7:69806627-69806649 GCTCATCAAAAAAATTAGCCAGG - Intronic
1026910912 7:74091354-74091376 TCTCTACAAAAAAATTAGCCAGG + Intronic
1027152164 7:75740157-75740179 TCTCTGCAAAAAAGATAGCCAGG - Intergenic
1028020870 7:85769387-85769409 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1028587465 7:92466325-92466347 TCTCTTAAAAAAAAATAGCTGGG - Intergenic
1029243254 7:99179743-99179765 TCTCTACAAAAAAATTAGCCAGG - Intronic
1029262276 7:99311291-99311313 TCTCTAGAAAAATAAAAGCCTGG - Intergenic
1029818672 7:103123803-103123825 TTTCGTAAAAAGTAACAGCCTGG + Intronic
1029965770 7:104738843-104738865 TCTCATCAAAAGTTATAGCAAGG - Intronic
1032257472 7:130308716-130308738 TCTACTGAAAAAAAATAGCCGGG - Intronic
1032982703 7:137302605-137302627 CCTTGTCAAAAATATTAACCTGG - Intronic
1038840461 8:31180283-31180305 TCTCTACAAAAATATTAGCTGGG - Intergenic
1040518916 8:48158718-48158740 TCTCTGCAAAAAAATTAGCCAGG - Intergenic
1041550513 8:59095565-59095587 TCTCTACAAAAAAATTAGCCGGG - Intronic
1044986833 8:97763303-97763325 TCTCTACAAAAAAAATAGCCGGG - Intergenic
1045040008 8:98214463-98214485 TCTCGTCAAAAATAATAGCCTGG - Intronic
1050054989 9:1642897-1642919 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1051668696 9:19489127-19489149 TCTCTTAAAAAAAAATAGCCAGG + Intergenic
1052285075 9:26775820-26775842 TCTTTTAAAAAAAAATAGCCAGG + Intergenic
1052914597 9:33914967-33914989 TCTCTACAAAAAAATTAGCCAGG + Intronic
1052918075 9:33939588-33939610 TCTCTACAAAAAAATTAGCCAGG + Intronic
1056647671 9:88429032-88429054 TCTCTACAAAAAAATTAGCCAGG - Intronic
1057584797 9:96319664-96319686 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1058580272 9:106448830-106448852 TCCCCCAAAAAATAATAGCCTGG + Intergenic
1060609629 9:124951209-124951231 CCAAGTTAAAAATAATAGCCAGG + Intronic
1060694833 9:125699780-125699802 TCTCTACAAAAATATTAGCCAGG - Intronic
1060697375 9:125720972-125720994 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1060845705 9:126835931-126835953 TCTCCTCAAATATAATGGCTAGG - Exonic
1185918413 X:4062463-4062485 TCTCTACAAAAAAATTAGCCAGG - Intergenic
1186482475 X:9906625-9906647 TCTCTACTAAAATATTAGCCAGG + Intronic
1187121743 X:16415363-16415385 TTTGGTCAAAATGAATAGCCTGG + Intergenic
1187192649 X:17050353-17050375 TCTCTACAAAAAAATTAGCCAGG - Intronic
1187881148 X:23848457-23848479 TTTCTTTAAAAATAATGGCCAGG - Intronic
1188293413 X:28416606-28416628 TCTTTTAAAAAATAATGGCCGGG + Intergenic
1189987417 X:46566290-46566312 TCTCTACAAAAAAAGTAGCCAGG + Intergenic
1190293780 X:49011986-49012008 TCTCAAAAAAAAAAATAGCCAGG - Intergenic
1192724346 X:73732199-73732221 TCTACTTAAAAAAAATAGCCAGG + Intergenic
1193354064 X:80496230-80496252 TAAAGTAAAAAATAATAGCCTGG + Intergenic
1195263673 X:103159599-103159621 TCTCTACAAAAAAATTAGCCAGG + Intergenic
1195805556 X:108761539-108761561 TCTCTATAAAAAAAATAGCCAGG - Intergenic
1197741801 X:129900679-129900701 TCTCTACAAAAATATTAGCTGGG - Intergenic
1198021395 X:132661860-132661882 TCTCTACAAAAAAATTAGCCAGG + Intronic
1198738370 X:139812685-139812707 TCTCTCCAAAAAAATTAGCCAGG - Intronic