ID: 1045047679

View in Genome Browser
Species Human (GRCh38)
Location 8:98294432-98294454
Sequence CCTCGGGGCCGCACTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 401}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045047677_1045047679 -10 Left 1045047677 8:98294419-98294441 CCAGTGTCTGCATCCTCGGGGCC 0: 1
1: 0
2: 0
3: 24
4: 170
Right 1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG 0: 1
1: 0
2: 1
3: 60
4: 401
1045047673_1045047679 -2 Left 1045047673 8:98294411-98294433 CCGCTGGGCCAGTGTCTGCATCC 0: 1
1: 0
2: 2
3: 19
4: 237
Right 1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG 0: 1
1: 0
2: 1
3: 60
4: 401
1045047669_1045047679 11 Left 1045047669 8:98294398-98294420 CCGCGCCCTCCTTCCGCTGGGCC 0: 1
1: 0
2: 1
3: 46
4: 586
Right 1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG 0: 1
1: 0
2: 1
3: 60
4: 401
1045047670_1045047679 6 Left 1045047670 8:98294403-98294425 CCCTCCTTCCGCTGGGCCAGTGT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG 0: 1
1: 0
2: 1
3: 60
4: 401
1045047666_1045047679 21 Left 1045047666 8:98294388-98294410 CCAGCTCGCACCGCGCCCTCCTT 0: 1
1: 0
2: 0
3: 19
4: 211
Right 1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG 0: 1
1: 0
2: 1
3: 60
4: 401
1045047665_1045047679 25 Left 1045047665 8:98294384-98294406 CCGTCCAGCTCGCACCGCGCCCT 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG 0: 1
1: 0
2: 1
3: 60
4: 401
1045047672_1045047679 2 Left 1045047672 8:98294407-98294429 CCTTCCGCTGGGCCAGTGTCTGC 0: 1
1: 0
2: 4
3: 18
4: 216
Right 1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG 0: 1
1: 0
2: 1
3: 60
4: 401
1045047671_1045047679 5 Left 1045047671 8:98294404-98294426 CCTCCTTCCGCTGGGCCAGTGTC 0: 1
1: 0
2: 0
3: 21
4: 162
Right 1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG 0: 1
1: 0
2: 1
3: 60
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045047679 Original CRISPR CCTCGGGGCCGCACTGCCCA AGG Intergenic