ID: 1045050589

View in Genome Browser
Species Human (GRCh38)
Location 8:98320677-98320699
Sequence CAAAATGCTGATAGCAATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045050589_1045050593 4 Left 1045050589 8:98320677-98320699 CCCGTATTGCTATCAGCATTTTG No data
Right 1045050593 8:98320704-98320726 AAGCCATTCAACAATTCTCTAGG 0: 20
1: 1599
2: 1920
3: 1355
4: 899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045050589 Original CRISPR CAAAATGCTGATAGCAATAC GGG (reversed) Intergenic
No off target data available for this crispr