ID: 1045050593

View in Genome Browser
Species Human (GRCh38)
Location 8:98320704-98320726
Sequence AAGCCATTCAACAATTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5793
Summary {0: 20, 1: 1599, 2: 1920, 3: 1355, 4: 899}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045050590_1045050593 3 Left 1045050590 8:98320678-98320700 CCGTATTGCTATCAGCATTTTGG 0: 84
1: 309
2: 1394
3: 1902
4: 1520
Right 1045050593 8:98320704-98320726 AAGCCATTCAACAATTCTCTAGG 0: 20
1: 1599
2: 1920
3: 1355
4: 899
1045050589_1045050593 4 Left 1045050589 8:98320677-98320699 CCCGTATTGCTATCAGCATTTTG No data
Right 1045050593 8:98320704-98320726 AAGCCATTCAACAATTCTCTAGG 0: 20
1: 1599
2: 1920
3: 1355
4: 899
1045050588_1045050593 19 Left 1045050588 8:98320662-98320684 CCTGGACTGTATTGTCCCGTATT No data
Right 1045050593 8:98320704-98320726 AAGCCATTCAACAATTCTCTAGG 0: 20
1: 1599
2: 1920
3: 1355
4: 899
1045050587_1045050593 25 Left 1045050587 8:98320656-98320678 CCTCAGCCTGGACTGTATTGTCC No data
Right 1045050593 8:98320704-98320726 AAGCCATTCAACAATTCTCTAGG 0: 20
1: 1599
2: 1920
3: 1355
4: 899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045050593 Original CRISPR AAGCCATTCAACAATTCTCT AGG Intergenic
Too many off-targets to display for this crispr