ID: 1045054901

View in Genome Browser
Species Human (GRCh38)
Location 8:98360381-98360403
Sequence ATGGAGACACAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045054901_1045054906 5 Left 1045054901 8:98360381-98360403 CCTTCTTCCCTCTGTGTCTCCAT No data
Right 1045054906 8:98360409-98360431 GTCCAGTGCCTGTCATACTGTGG No data
1045054901_1045054907 6 Left 1045054901 8:98360381-98360403 CCTTCTTCCCTCTGTGTCTCCAT No data
Right 1045054907 8:98360410-98360432 TCCAGTGCCTGTCATACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045054901 Original CRISPR ATGGAGACACAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr