ID: 1045056179

View in Genome Browser
Species Human (GRCh38)
Location 8:98370165-98370187
Sequence CCCTAACACCAGTAGCCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045056174_1045056179 -9 Left 1045056174 8:98370151-98370173 CCCATCAAGCCTCTCCCTAACAC No data
Right 1045056179 8:98370165-98370187 CCCTAACACCAGTAGCCCCCGGG No data
1045056173_1045056179 8 Left 1045056173 8:98370134-98370156 CCAGTTTGTCTCTAAGGCCCATC No data
Right 1045056179 8:98370165-98370187 CCCTAACACCAGTAGCCCCCGGG No data
1045056175_1045056179 -10 Left 1045056175 8:98370152-98370174 CCATCAAGCCTCTCCCTAACACC No data
Right 1045056179 8:98370165-98370187 CCCTAACACCAGTAGCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045056179 Original CRISPR CCCTAACACCAGTAGCCCCC GGG Intergenic
No off target data available for this crispr