ID: 1045056536

View in Genome Browser
Species Human (GRCh38)
Location 8:98373010-98373032
Sequence CATGGTGAAATTCCATTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045056536_1045056545 25 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056545 8:98373058-98373080 GACAGAGAGAGTCAGATGAGGGG No data
1045056536_1045056540 -3 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056540 8:98373030-98373052 ATGAATTAAAGCACTGTAGGAGG No data
1045056536_1045056544 24 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056544 8:98373057-98373079 AGACAGAGAGAGTCAGATGAGGG No data
1045056536_1045056546 29 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056546 8:98373062-98373084 GAGAGAGTCAGATGAGGGGAAGG No data
1045056536_1045056541 -2 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056541 8:98373031-98373053 TGAATTAAAGCACTGTAGGAGGG No data
1045056536_1045056543 23 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056543 8:98373056-98373078 AAGACAGAGAGAGTCAGATGAGG No data
1045056536_1045056542 -1 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056542 8:98373032-98373054 GAATTAAAGCACTGTAGGAGGGG No data
1045056536_1045056538 -6 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056538 8:98373027-98373049 ACCATGAATTAAAGCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045056536 Original CRISPR CATGGTGAAATTCCATTTCA GGG (reversed) Intergenic
No off target data available for this crispr