ID: 1045056539

View in Genome Browser
Species Human (GRCh38)
Location 8:98373028-98373050
Sequence TCCTACAGTGCTTTAATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045056539_1045056547 22 Left 1045056539 8:98373028-98373050 CCATGAATTAAAGCACTGTAGGA No data
Right 1045056547 8:98373073-98373095 ATGAGGGGAAGGAAATTCGTTGG No data
1045056539_1045056546 11 Left 1045056539 8:98373028-98373050 CCATGAATTAAAGCACTGTAGGA No data
Right 1045056546 8:98373062-98373084 GAGAGAGTCAGATGAGGGGAAGG No data
1045056539_1045056548 23 Left 1045056539 8:98373028-98373050 CCATGAATTAAAGCACTGTAGGA No data
Right 1045056548 8:98373074-98373096 TGAGGGGAAGGAAATTCGTTGGG No data
1045056539_1045056545 7 Left 1045056539 8:98373028-98373050 CCATGAATTAAAGCACTGTAGGA No data
Right 1045056545 8:98373058-98373080 GACAGAGAGAGTCAGATGAGGGG No data
1045056539_1045056543 5 Left 1045056539 8:98373028-98373050 CCATGAATTAAAGCACTGTAGGA No data
Right 1045056543 8:98373056-98373078 AAGACAGAGAGAGTCAGATGAGG No data
1045056539_1045056544 6 Left 1045056539 8:98373028-98373050 CCATGAATTAAAGCACTGTAGGA No data
Right 1045056544 8:98373057-98373079 AGACAGAGAGAGTCAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045056539 Original CRISPR TCCTACAGTGCTTTAATTCA TGG (reversed) Intergenic
No off target data available for this crispr