ID: 1045056546

View in Genome Browser
Species Human (GRCh38)
Location 8:98373062-98373084
Sequence GAGAGAGTCAGATGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045056536_1045056546 29 Left 1045056536 8:98373010-98373032 CCCTGAAATGGAATTTCACCATG No data
Right 1045056546 8:98373062-98373084 GAGAGAGTCAGATGAGGGGAAGG No data
1045056539_1045056546 11 Left 1045056539 8:98373028-98373050 CCATGAATTAAAGCACTGTAGGA No data
Right 1045056546 8:98373062-98373084 GAGAGAGTCAGATGAGGGGAAGG No data
1045056537_1045056546 28 Left 1045056537 8:98373011-98373033 CCTGAAATGGAATTTCACCATGA No data
Right 1045056546 8:98373062-98373084 GAGAGAGTCAGATGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045056546 Original CRISPR GAGAGAGTCAGATGAGGGGA AGG Intergenic
No off target data available for this crispr