ID: 1045062897

View in Genome Browser
Species Human (GRCh38)
Location 8:98424255-98424277
Sequence CTTGAATGGCAGAGTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045062897_1045062901 -9 Left 1045062897 8:98424255-98424277 CCAAGTTCACTCTGCCATTCAAG 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1045062901 8:98424269-98424291 CCATTCAAGGAAAGGTGAGCAGG No data
1045062897_1045062902 -8 Left 1045062897 8:98424255-98424277 CCAAGTTCACTCTGCCATTCAAG 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1045062902 8:98424270-98424292 CATTCAAGGAAAGGTGAGCAGGG No data
1045062897_1045062904 -6 Left 1045062897 8:98424255-98424277 CCAAGTTCACTCTGCCATTCAAG 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1045062904 8:98424272-98424294 TTCAAGGAAAGGTGAGCAGGGGG No data
1045062897_1045062903 -7 Left 1045062897 8:98424255-98424277 CCAAGTTCACTCTGCCATTCAAG 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1045062903 8:98424271-98424293 ATTCAAGGAAAGGTGAGCAGGGG No data
1045062897_1045062905 -5 Left 1045062897 8:98424255-98424277 CCAAGTTCACTCTGCCATTCAAG 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1045062905 8:98424273-98424295 TCAAGGAAAGGTGAGCAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045062897 Original CRISPR CTTGAATGGCAGAGTGAACT TGG (reversed) Intronic
906636439 1:47413480-47413502 CTTCAAGAGCAGAGTGACCTGGG - Intergenic
908064468 1:60387876-60387898 ATTGACTGGCTGTGTGAACTTGG - Intergenic
911168511 1:94746151-94746173 ATTGAATGACAGGGTGAACATGG - Intergenic
911251854 1:95585521-95585543 CTTGACTGGCAGAGTGGGGTCGG + Intergenic
916166892 1:161972835-161972857 CTAGAGGGGCAGGGTGAACTAGG + Intergenic
922755704 1:228095720-228095742 CTTGAAGGGCAGAGAGAAAAGGG - Intronic
924263310 1:242253907-242253929 ATTGAATTGCAGACTTAACTTGG + Intronic
1065423048 10:25568333-25568355 CTTGAATGGCAGTGTTTACAAGG - Intronic
1066721479 10:38344550-38344572 ATTGAATTGCAGACTTAACTTGG - Intergenic
1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG + Intronic
1073633416 10:105172354-105172376 GTTGAATGGTAGTGTGTACTTGG + Intronic
1074576343 10:114673296-114673318 CTTGAATGGCAGTGTGGTGTTGG - Intronic
1075772565 10:124952242-124952264 CTTAAATGGCAGGGTTATCTGGG + Intronic
1077735897 11:4790443-4790465 ATTGAATCCCAGAGTGAAATGGG - Intronic
1078598127 11:12706791-12706813 CTTGAGTGGGAGAGTCAGCTTGG + Intronic
1079295186 11:19226652-19226674 CTACAATGGCAGAGTTGACTAGG + Intronic
1079424545 11:20327617-20327639 CTTGAAAGCCAGAGTGTGCTTGG + Intergenic
1081825859 11:46050985-46051007 GCTGAATGGCACAGAGAACTCGG - Intronic
1085743048 11:79093288-79093310 CTGGACTGGCAGAGGGAGCTTGG + Intronic
1086192794 11:84099436-84099458 ATTTAATAGAAGAGTGAACTTGG + Intronic
1087277061 11:96171182-96171204 ATTGGAGGGAAGAGTGAACTGGG + Intronic
1088071114 11:105786261-105786283 CTTGAATAGAAGATTCAACTCGG - Intronic
1095570183 12:43675503-43675525 CTGGAATGGCTCAGTGATCTGGG + Intergenic
1095878257 12:47105220-47105242 TTTGATTGACAGAGTGAACGCGG + Intronic
1098078825 12:66761581-66761603 AATGCATGGCAGAGTTAACTGGG - Intronic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1101788568 12:107908335-107908357 ATTTAATGGCTGAGTGAGCTTGG - Intergenic
1102823599 12:115927804-115927826 CTTGGATGGCAGAATGAACCTGG - Intergenic
1108504757 13:51102715-51102737 CTTTAATAGCAGTGTGAACATGG - Intergenic
1108569479 13:51735226-51735248 ATTGAGTGGCAGAGAGAAATAGG - Intronic
1110325625 13:74211388-74211410 CCTGAATGGCTGTGTGAATTAGG + Intergenic
1110773829 13:79382934-79382956 CTGAAATGTCAGAGAGAACTTGG + Intronic
1119854374 14:77888239-77888261 CTTGGAGGACAGAGTGTACTTGG + Intronic
1120347173 14:83306051-83306073 CTTGATTGTCAGAGTGAAAGGGG + Intergenic
1121987733 14:98524336-98524358 CTTAACTGGCTGTGTGAACTTGG - Intergenic
1122457394 14:101864972-101864994 CTTTGATGGCAGAGAGAAATGGG + Intronic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1129068639 15:72932654-72932676 CTTTCATGGCAGAGGCAACTGGG - Intergenic
1130959743 15:88652005-88652027 CTTGACTGGCTGTGTGACCTTGG - Intronic
1134513460 16:14867582-14867604 CCTGAAAGGCAGTGTGAAATGGG + Intronic
1134701097 16:16266075-16266097 CCTGAAAGGCAGTGTGAAATGGG + Intronic
1134970730 16:18528570-18528592 CCTGAAAGGCAGTGTGAAATGGG - Intronic
1135990705 16:27216994-27217016 CTTGAAAGTCACTGTGAACTTGG - Intronic
1140881732 16:79204664-79204686 ATTGAAGGGCAGGGTGACCTTGG - Intronic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1144864021 17:18323458-18323480 CTTGAGTGGCAAAATGAACGAGG + Intergenic
1146490945 17:33281749-33281771 CTTGAATGGCTGGGTGACTTAGG + Intronic
1147178822 17:38672795-38672817 CTTTAATGGGTGAGGGAACTTGG - Exonic
1149857003 17:60091514-60091536 TTTGAATGACAGAGAGAAATGGG + Intergenic
1156231230 18:35155771-35155793 ACTGAATGGCAGTGTGACCTTGG + Intergenic
1158340849 18:56464686-56464708 TTTGAATGGTACAGTTAACTTGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159253426 18:65912040-65912062 CTTAAATTGCAGAGAAAACTTGG + Intergenic
1165200623 19:34141445-34141467 ATGGAATGGCATAGTGAATTGGG + Intergenic
1167634322 19:50645280-50645302 ATTGAGTGGCAGAGGGAAGTCGG + Intronic
925785127 2:7424410-7424432 TTTGAATGGAAGATTGAACATGG + Intergenic
926087996 2:10032181-10032203 CATGAATGGCCCAGTGAGCTGGG + Intergenic
927035735 2:19174272-19174294 CGTGAAAGGCAGTGTAAACTGGG - Intergenic
927768274 2:25833807-25833829 CTTTAAGGGAAGAGTGAACTTGG - Intronic
929080939 2:38121444-38121466 CTTCAAATACAGAGTGAACTTGG + Intergenic
931124317 2:59256976-59256998 CTTGAAGGGAAGGGAGAACTAGG + Intergenic
935407559 2:102724925-102724947 CTTAAATGTCAGAGAGGACTGGG + Intronic
936390275 2:112066445-112066467 CTTGAATGGATGAATGAACCAGG - Intronic
937787389 2:125917829-125917851 CATGAAAGTGAGAGTGAACTGGG + Intergenic
939882062 2:147642062-147642084 CTTGAACAGCTGGGTGAACTTGG + Intergenic
940565652 2:155356923-155356945 CTGGAATGGCATGGTGATCTGGG - Intergenic
940766925 2:157799570-157799592 CTTGAATGGCAGTTTGAAGGTGG - Intronic
941153579 2:161946487-161946509 ATTGAATTGCAGAGAGATCTTGG - Intronic
941628118 2:167852640-167852662 CTTGAATGGCACAGTGAAAAGGG + Intergenic
943543404 2:189244812-189244834 CTTTATTGGCAGAGTGAAAATGG - Intergenic
943619668 2:190134607-190134629 TTTAAATGGCATAGTGAATTAGG + Intronic
945208112 2:207353698-207353720 CTTGAAGGGCAGAAAGAATTGGG - Intergenic
947117713 2:226790208-226790230 CTTCACTAGCAGAGTGACCTTGG - Intronic
948311640 2:236991568-236991590 CAAGAAGGGCAGAGTGAAGTGGG - Intergenic
1168813975 20:724062-724084 CTTGGAAGGCAGAGTGCTCTGGG + Intergenic
1168848881 20:963119-963141 CTTGAATGGCACAGTGAAGGGGG + Intronic
1170066038 20:12311655-12311677 CTTGACTGGGAGTGTGAAGTGGG - Intergenic
1170275718 20:14584513-14584535 CTTGCATGGCAGAGAGAAAAAGG + Intronic
1171280147 20:23889517-23889539 CATGAATGGCAGACTTAGCTGGG - Intergenic
1171314627 20:24178443-24178465 CATGAGTGGCAGAGTGAATGGGG - Intergenic
1172350785 20:34238873-34238895 CTTGGATGGCAAAGTGTCCTTGG - Intronic
1172827781 20:37805083-37805105 CATGAATGGCAGAGTGAGAATGG + Intronic
1173333157 20:42092407-42092429 CTTCAAAGACAGAATGAACTTGG + Intronic
1174901553 20:54506052-54506074 CATGAGTGGCAGCTTGAACTGGG + Intronic
1175830297 20:61961401-61961423 CATGAATGGTAGAGTGGACTTGG - Intronic
1183130493 22:35830099-35830121 GTTGAATGGGAGAGTTAAATTGG - Intronic
1184402127 22:44280386-44280408 CTTGTGTGGATGAGTGAACTTGG - Intronic
949171618 3:1005557-1005579 CTTGCCTGGCAGAGTTAATTTGG + Intergenic
949607821 3:5673832-5673854 CTTGGAAGTCAGAGTGAACTTGG - Intergenic
949609578 3:5690725-5690747 CTAGAATGGCAGAGTTGAATAGG + Intergenic
949975346 3:9452567-9452589 CTTGGAAGGAAGAGTGAACAAGG - Intronic
951164665 3:19470577-19470599 TGTGAATGGCAGAGTGATCGGGG + Intronic
953088030 3:39692611-39692633 CTGGTCTGGCAGAATGAACTGGG - Intergenic
955685612 3:61545622-61545644 CTGGAATTGCAGAGAGAGCTGGG - Intergenic
958632721 3:96702613-96702635 CTTGAAAGGCTGAGAGGACTTGG + Intergenic
960458961 3:117909574-117909596 TTTGAATGAAAGAATGAACTTGG - Intergenic
960462951 3:117959344-117959366 CATGAATGGCAGAGTGAGAGGGG + Intergenic
961566607 3:127768572-127768594 CTTGGATGTCAGAGTAAAGTAGG - Intronic
964170903 3:153768497-153768519 CTGGAATGGCAAGGTGATCTGGG + Intergenic
965591724 3:170366620-170366642 GATGAAGGGCAGTGTGAACTCGG - Intronic
967139583 3:186543843-186543865 CTTGAATGGAAGAGAGATGTAGG + Intronic
969090851 4:4692967-4692989 CTTGGGTGACAGAGTGGACTTGG + Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
970496051 4:16627383-16627405 CTTGTATAGAAGAGTGGACTGGG - Intronic
973878433 4:55244041-55244063 CTGGAATGAAAGAGTGAGCTGGG + Intergenic
976886548 4:89991713-89991735 CTAGAATGGGAGCATGAACTTGG - Intergenic
977873761 4:102124946-102124968 CTTGGATAGCTGAGTGACCTTGG + Intergenic
978497632 4:109377277-109377299 GTTGAATGGAAGAATGAACAAGG - Intergenic
990732255 5:58822284-58822306 CTTTACTGGCTGAGTGATCTTGG + Intronic
990748564 5:58986325-58986347 CTTAAATGGCAGACTGCACAGGG + Intronic
990969890 5:61493816-61493838 CTTGAATCACAAAGTGTACTTGG + Intronic
991017870 5:61950535-61950557 ATTGAATGGCTGTGTGATCTTGG + Intergenic
993258541 5:85626559-85626581 CTTGAATGGAAAAGTTGACTAGG - Intergenic
993426325 5:87769119-87769141 TTTGAATGGCAGACTGCAATTGG - Intergenic
993927088 5:93879432-93879454 CTTGAATTGATGAGTGAAATGGG + Intronic
994190940 5:96868541-96868563 CCTGAATGGCTGAGTGGACTTGG - Intronic
995726781 5:115189889-115189911 CTTTATTGGAACAGTGAACTTGG - Intergenic
996177221 5:120373588-120373610 GTTGCATGGCAGAGTGAGTTGGG + Intergenic
998618805 5:143771832-143771854 CCTGAGTGGCTGAGTGAGCTGGG - Intergenic
1000897302 5:166871185-166871207 CTTGGTTGACAGAGTGAACAAGG - Intergenic
1001892764 5:175352978-175353000 ATTCAATGGGAGAGTGAAGTGGG + Intergenic
1001977324 5:176010476-176010498 TTTCAATGGGAGAGTAAACTGGG + Intronic
1002240102 5:177833304-177833326 TTTCAATGGGAGAGTAAACTGGG - Intergenic
1004345281 6:14843629-14843651 CTACCATGGCAGAGTGAACATGG - Intergenic
1005355567 6:24980131-24980153 ATGGAATGGCAGAGAAAACTTGG - Intronic
1005766191 6:29014650-29014672 CTTGAATGTGAGACTGAATTAGG - Intergenic
1010974226 6:82294761-82294783 CTTGAAAGTCAGACTGAACTGGG + Intergenic
1014879714 6:126708496-126708518 CTTGAATAGCTGAGTGAATTGGG + Intergenic
1015571590 6:134626663-134626685 CTTGAATGCCAGAGAGAGCCAGG - Intergenic
1015897603 6:138032539-138032561 CTAGAAATGCATAGTGAACTAGG + Intergenic
1019046217 6:169148702-169148724 CTTTAACGGCTGAATGAACTGGG + Intergenic
1019429143 7:990773-990795 CTTGAAGGGCAGAAAGAACGGGG + Intergenic
1020079726 7:5281065-5281087 CTTGAAGGGCAGACTGCATTGGG - Intronic
1021588104 7:22231654-22231676 GTTGAATGTCAGTGTGAAATTGG - Intronic
1023360106 7:39406769-39406791 TTTTTATGGCAGATTGAACTCGG + Intronic
1025199180 7:56951138-56951160 CTTGAAGGGCAGACTGCATTGGG + Intergenic
1025672767 7:63625795-63625817 CTTGAAGGGCAGACTGCATTGGG - Intergenic
1027188623 7:75985736-75985758 CTTGAAGGGCAGGCGGAACTGGG - Exonic
1029339609 7:99932457-99932479 TTTGGAAGGCAGAGTAAACTTGG - Intergenic
1029910037 7:104135896-104135918 GTAGACTGGCAGAGTGAACAGGG - Intronic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1035340690 7:158158934-158158956 CCTGAATGAATGAGTGAACTCGG + Intronic
1035340702 7:158159002-158159024 CCTGAATGAATGAGTGAACTCGG + Intronic
1035671248 8:1418916-1418938 CTTGAATGGCTCACAGAACTCGG + Intergenic
1038048952 8:23791107-23791129 CTTGTCTTGCAGAGTGACCTGGG + Intergenic
1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG + Intronic
1042736462 8:71994984-71995006 CTTGAAGGGCTCAGTAAACTAGG - Intronic
1044985851 8:97755914-97755936 CTGGAGTGGCAGTGTGATCTCGG + Intergenic
1045062897 8:98424255-98424277 CTTGAATGGCAGAGTGAACTTGG - Intronic
1049039643 8:140102745-140102767 CAAGAATGGCAGTGTGGACTCGG + Intronic
1049240598 8:141535693-141535715 CTTGACTCGGAGAGTGACCTTGG + Intergenic
1055805007 9:80083108-80083130 GTTGAATGACAAAATGAACTAGG - Intergenic
1058066884 9:100558624-100558646 CTTGAATTCCTTAGTGAACTGGG - Intronic
1058710536 9:107675186-107675208 CTAGAAGGTCAGAGAGAACTGGG + Intergenic
1059598443 9:115748513-115748535 CTGGTATGGCAGAGTGGAATAGG - Intergenic
1059622250 9:116019702-116019724 CTACAATGGCAGAGTTAAGTAGG - Intergenic
1061738651 9:132682190-132682212 CTAGAATAGCAGAGTGAGTTTGG + Intronic
1061936507 9:133860638-133860660 CTGGAATGGCAGAGAGAGCCTGG - Intronic
1185891073 X:3822535-3822557 GTTGAATGGCAGCCTGCACTAGG + Intronic
1185896177 X:3860951-3860973 GTTGAATGGCAGCCTGCACTAGG + Intergenic
1185901296 X:3899377-3899399 GTTGAATGGCAGCCTGCACTAGG + Intergenic
1185906405 X:3937809-3937831 GTTGAATGGCAGCCTGCACTAGG + Intergenic
1186767231 X:12783089-12783111 CTTACATGGGAGAGTGAAGTGGG + Intergenic
1190741922 X:53294536-53294558 CCTAATTGGCAGTGTGAACTCGG + Intronic
1191832426 X:65429888-65429910 CTTGAATGGCTGAGTCAACTAGG + Intronic
1198452292 X:136778986-136779008 CTTGAAAAGCTGAGAGAACTTGG - Intronic
1199975081 X:152890005-152890027 CTTGGATGGCAGAGGGAATGAGG + Intergenic