ID: 1045064685

View in Genome Browser
Species Human (GRCh38)
Location 8:98435012-98435034
Sequence CAGTCCAGGTGGAGAGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045064685_1045064698 15 Left 1045064685 8:98435012-98435034 CCCACTGCTCTCCACCTGGACTG 0: 1
1: 0
2: 1
3: 26
4: 293
Right 1045064698 8:98435050-98435072 TGCCAGAGGGCTCCACAATCTGG No data
1045064685_1045064691 1 Left 1045064685 8:98435012-98435034 CCCACTGCTCTCCACCTGGACTG 0: 1
1: 0
2: 1
3: 26
4: 293
Right 1045064691 8:98435036-98435058 CCCCCATCCCTGCTTGCCAGAGG No data
1045064685_1045064693 2 Left 1045064685 8:98435012-98435034 CCCACTGCTCTCCACCTGGACTG 0: 1
1: 0
2: 1
3: 26
4: 293
Right 1045064693 8:98435037-98435059 CCCCATCCCTGCTTGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045064685 Original CRISPR CAGTCCAGGTGGAGAGCAGT GGG (reversed) Intronic
900553694 1:3269388-3269410 CAGTCCCGGAGGAGGACAGTCGG + Intronic
900553720 1:3269495-3269517 CAGTCCAGGAGGAGGACAGTTGG + Intronic
900553738 1:3269571-3269593 CAGTCCCGGAGGAGGACAGTCGG + Intronic
900553753 1:3269634-3269656 CAGTCCCGGAGGAGGACAGTTGG + Intronic
900553770 1:3269711-3269733 CAGTCCCGGAGGAGGACAGTTGG + Intronic
900553815 1:3269910-3269932 CAGTCCAGGAGGAGGACAATCGG + Intronic
900553864 1:3270139-3270161 CAGTCCCGGAGGAGGACAGTCGG + Intronic
900553896 1:3270270-3270292 CAGTCCCGGAGGAGGACAGTGGG + Intronic
900553933 1:3270442-3270464 CAGTCCAGAAGGAGGACAGTCGG + Intronic
900553990 1:3270700-3270722 CAGTCCCGGAGGAGGACAGTCGG + Intronic
900554035 1:3270871-3270893 CAGTCCAGGAGGAGGACCGTTGG + Intronic
900661294 1:3785360-3785382 CTGGCCGGGTGGAGAGGAGTTGG - Intronic
903769161 1:25753318-25753340 AAGTCCACGTGGCCAGCAGTTGG + Intronic
904203510 1:28837316-28837338 CAGAGCAGGAGGTGAGCAGTGGG - Intronic
905511438 1:38524217-38524239 CAGCCCATGTGGAAAGCAGAAGG - Intergenic
905869674 1:41396025-41396047 CAGTTCAGGTGGAGGGAAGGTGG - Intergenic
908343405 1:63205904-63205926 CACAGCAGGTGGTGAGCAGTGGG + Intergenic
908986907 1:70035295-70035317 CAGGCAGGGTGGAGAGCATTAGG - Intronic
909421442 1:75470783-75470805 CTGTCCAGGTGGAGAGATGTGGG + Intronic
909457478 1:75866642-75866664 CAGTCCAGGTATTGTGCAGTGGG + Intronic
911762460 1:101631857-101631879 CAATCCAGGTGGGGAGGAGATGG + Intergenic
914678247 1:149920209-149920231 AAGTCCAGCAGGAGAGCATTTGG + Intergenic
914830717 1:151169062-151169084 CAGTCCAAGGGGAGATCAGGTGG - Exonic
915527334 1:156483929-156483951 CAGAGCAGGTCTAGAGCAGTGGG + Intronic
917480566 1:175408144-175408166 CAGTCCAGGTGGGGAGAAGCAGG - Intronic
917837508 1:178952940-178952962 CAGCCCAGGGAGAGAACAGTGGG + Intergenic
919283616 1:195523822-195523844 CAGCCCTTGTGGAGAGCAATTGG + Intergenic
922744451 1:228036455-228036477 CAGGCCAGGTGGACGGCAGATGG - Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
923556860 1:235007915-235007937 CAGTCCAGGAGGACAGAAGTTGG + Intergenic
924452682 1:244192506-244192528 CAGGGCAGGTGGAGAGCACCCGG + Intergenic
1062791231 10:307839-307861 CAGTCCATCTGGAGGGCAGCAGG + Intronic
1063761603 10:9084754-9084776 AAATCCAGGTGGAGCTCAGTGGG - Intergenic
1065464443 10:26004086-26004108 GAGTCCAGGTGCAGCTCAGTAGG + Intronic
1065845198 10:29737297-29737319 CGGTCCAGGTGGAGGGGATTGGG - Intergenic
1066450576 10:35524805-35524827 CTGTCCAGTTGGAGACCACTTGG + Intronic
1067429176 10:46231648-46231670 CAGGCCAGCTGCAGAGAAGTGGG + Intergenic
1067786621 10:49254982-49255004 CGGTGCAGGTGGAGGGCAGTGGG - Intergenic
1069136478 10:64772948-64772970 CACAGCAGGTGGTGAGCAGTGGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1073353405 10:102835526-102835548 CAGTCATGGTGGAGTGCAGTGGG - Intronic
1073791930 10:106949351-106949373 ACGTCCAGGGGAAGAGCAGTGGG - Intronic
1074129315 10:110559212-110559234 CAGTCCTGGTGGGGTGAAGTGGG - Intergenic
1074911809 10:117917594-117917616 AAGTCCAGGTGAGGAGTAGTTGG + Intergenic
1075985305 10:126779968-126779990 CAGTCCATGTGAAGGGGAGTAGG - Intergenic
1076157683 10:128216087-128216109 CAGGGCAGGTGGAGGGCAGAGGG + Intergenic
1076907423 10:133370163-133370185 CAGGCCACGTGGACAGCTGTAGG + Intronic
1077393887 11:2311883-2311905 CAGGCCCCGTGGAGAGCAGCCGG + Intronic
1077457319 11:2688836-2688858 CACTCCAGGTGGAGAGGGCTGGG + Intronic
1078337047 11:10472961-10472983 CAGCCAGGCTGGAGAGCAGTGGG - Intronic
1081701965 11:45157969-45157991 CTGTGCAGGAGGTGAGCAGTGGG + Intronic
1081758501 11:45560931-45560953 CAGGCCTGGTGGCGGGCAGTGGG + Intergenic
1081996655 11:47369448-47369470 CACTCTGGGTGGAGAGCAGATGG - Intronic
1084652197 11:70495803-70495825 CATTCCAGGTGGCGAGCTCTGGG + Intronic
1085280715 11:75328631-75328653 CACACCAGGTGGCCAGCAGTTGG - Intronic
1085603338 11:77875279-77875301 CAGTCCAGGTACAGATCAGTTGG + Intronic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1087698023 11:101403124-101403146 CAGTCCAGGTGGAGCTTGGTGGG - Intergenic
1087876270 11:103361686-103361708 CAGAGCAGATGAAGAGCAGTGGG + Intronic
1088842686 11:113639983-113640005 CAGTTCAGGTGGAGAGGGTTAGG + Intergenic
1089634245 11:119802129-119802151 CAGACAAGGTGCAGAGCAGCAGG + Intergenic
1092815894 12:12312065-12312087 CAATCCAAGAAGAGAGCAGTAGG + Intergenic
1093362910 12:18254337-18254359 CAAACCATGTGGAGAGCTGTAGG + Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1095577529 12:43757854-43757876 CAGTCCAGATACAGAGCAGTGGG + Intronic
1096654494 12:53079930-53079952 CATTCCAGGAGGAGAGAACTGGG + Intergenic
1099810051 12:87569113-87569135 CACAGCAGGTGGTGAGCAGTGGG + Intergenic
1100625583 12:96328004-96328026 CAGGCCAAGAGGTGAGCAGTTGG + Intronic
1100727017 12:97419379-97419401 CACTCCAGGTGGCAAGAAGTGGG + Intergenic
1102019174 12:109669796-109669818 CAGGCAAGTTGGAGAGCAGACGG + Intergenic
1102306515 12:111808835-111808857 CAGTGCAGGTGGAGAAAAGAGGG + Intronic
1103467461 12:121153211-121153233 CAGCCAAGGTGGAGAACAGCTGG + Intronic
1105545879 13:21350705-21350727 CACCCCAGCTGGAGTGCAGTGGG - Intergenic
1107340353 13:39398709-39398731 CAGAGCAGGTGGGGAGCGGTGGG + Intronic
1107631523 13:42348057-42348079 CAGCCACTGTGGAGAGCAGTTGG - Intergenic
1110046722 13:70841528-70841550 CAGTCCTGGTGTGGAGGAGTGGG + Intergenic
1111034089 13:82647743-82647765 CAGGGCAGGAGGTGAGCAGTGGG - Intergenic
1113056707 13:106275835-106275857 CAGTCAGGGTGGAGCGGAGTTGG + Intergenic
1114879114 14:26761754-26761776 CAGAGCAGGAGGTGAGCAGTGGG + Intergenic
1116926319 14:50641779-50641801 CAGTCACAGTGGAAAGCAGTTGG + Intronic
1118458772 14:65969018-65969040 CAGTCCAGCTGCAGACCAGAGGG - Intronic
1119019616 14:71097380-71097402 CAGTCACTGTGGAAAGCAGTTGG - Intronic
1119393340 14:74306646-74306668 TGGTCCAGGTAGAGTGCAGTGGG + Intronic
1119910275 14:78343747-78343769 CGGCCAAGGTGGAGAACAGTGGG - Intronic
1121170099 14:91846563-91846585 TACTCCAGGTTGAGAGCTGTTGG - Intronic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1122246724 14:100408276-100408298 CAGTGAAGGAGGGGAGCAGTGGG - Intronic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1122949772 14:105036385-105036407 TTGCCCAGGTGGAGTGCAGTGGG + Intergenic
1124413473 15:29455709-29455731 CACTGCAGGAGGTGAGCAGTGGG + Intronic
1124606280 15:31172315-31172337 CAGTCCAGGTGCAGAGCCAGAGG - Intergenic
1125958317 15:43807008-43807030 CATTCCAGGTGGAGACCAGCAGG - Intronic
1128179099 15:65585239-65585261 AAGTTCAGTTGGAGAGCACTGGG - Intronic
1128545642 15:68565924-68565946 CAGACCAGGGTGAGAGCAGAAGG + Intergenic
1128559038 15:68652428-68652450 CAGTCCGGGTGAAGTGCAGCAGG - Intronic
1129264001 15:74384256-74384278 CTGGCCAGGTGGTGAGCAGGGGG - Intergenic
1130063764 15:80588283-80588305 AAAGCCAGCTGGAGAGCAGTGGG - Intronic
1130736635 15:86557287-86557309 CCGTCCATGTGGACAGCTGTGGG + Intronic
1131615684 15:94014925-94014947 CAGAGCAGGAGGATAGCAGTTGG - Intergenic
1132289104 15:100686805-100686827 GAGCCCTGGTGGGGAGCAGTGGG + Intergenic
1132628097 16:901927-901949 CGAACCGGGTGGAGAGCAGTGGG + Intronic
1132870741 16:2114737-2114759 CAGCCCAGCTGGAGGGCACTTGG - Exonic
1133660337 16:7910323-7910345 CACAGCAGGAGGAGAGCAGTGGG - Intergenic
1134521788 16:14922167-14922189 CAGCCCAGCTGGAGGGCACTTGG + Intronic
1134583812 16:15394542-15394564 CAGCCAGGGTGGAGTGCAGTGGG + Intergenic
1134709458 16:16320818-16320840 CAGCCCAGCTGGAGGGCACTTGG + Intergenic
1134716671 16:16360847-16360869 CAGCCCAGCTGGAGGGCACTTGG + Intergenic
1134904314 16:17966940-17966962 GATTCCAGGTGGAGGGTAGTAGG - Intergenic
1134950145 16:18347827-18347849 CAGCCCAGCTGGAGGGCACTTGG - Intergenic
1134958079 16:18391312-18391334 CAGCCCAGCTGGAGGGCACTTGG - Intergenic
1135157489 16:20065383-20065405 CAGACCAGGTCGAGAGAAGTGGG - Intronic
1136192473 16:28624823-28624845 CAGCCAGGGTGGAGTGCAGTGGG - Intergenic
1136253761 16:29024628-29024650 CAGTCCAGGGGGAAAGAAGGTGG + Intergenic
1139859502 16:70009686-70009708 CAGCCAGGGTGGAGTGCAGTGGG + Intergenic
1142200581 16:88759421-88759443 CAGGCCAGGGGGAGGGCAGCTGG - Intronic
1142218146 16:88839887-88839909 CAGGCCAGGCGGAGAGCTCTGGG + Intronic
1143576082 17:7794168-7794190 CAGGCCAGGTGAAAAGGAGTGGG - Intronic
1144535192 17:16081916-16081938 CAGCCTAAGTTGAGAGCAGTGGG - Intronic
1144672045 17:17138336-17138358 CCTTCCAGGTGGAGAGAAGGCGG + Intronic
1145866626 17:28246143-28246165 CAGGCAAGGTGGAAAGAAGTGGG - Intergenic
1145999841 17:29124574-29124596 CAGCCCAGGTGCAGGCCAGTGGG + Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1147925491 17:43943002-43943024 CAGGCAAGGTGGAAAGGAGTGGG + Intergenic
1148745231 17:49914296-49914318 CAGTCCTGGGAGAGAGCAGCCGG - Intergenic
1149986751 17:61353275-61353297 CAGGCCAGGGGGAGGGGAGTAGG + Intronic
1150522049 17:65878802-65878824 CAGTCCAGGTGAAAAACAGAAGG + Intronic
1151790159 17:76300402-76300424 CAGACCAGGATGAAAGCAGTGGG + Intronic
1153719821 18:7890397-7890419 CAGTCCAGGGAGAGAGAAATTGG - Intronic
1154332508 18:13441356-13441378 CCGTCCAGGTGGAGAGGAAGGGG - Intronic
1155084928 18:22448800-22448822 CAGCCCCTGTGGAAAGCAGTTGG + Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1157795748 18:50573324-50573346 CACAGCAGGAGGAGAGCAGTGGG + Intronic
1158292657 18:55958540-55958562 CAGTTCAGGAGAAGAACAGTTGG - Intergenic
1161058799 19:2203938-2203960 GAGGACAGGTGGGGAGCAGTTGG - Intronic
1162054116 19:8052663-8052685 GAGTGCAGGTGGAGAGGAGGAGG + Intronic
1162057487 19:8073360-8073382 CATTCCAGGTGGAGGGCTCTGGG - Intronic
1162391875 19:10394925-10394947 GAGTCCCAGTGGAGAGGAGTCGG + Intronic
1163050560 19:14680150-14680172 CATTCCAGGTGGGGCACAGTGGG - Intronic
1165660651 19:37577934-37577956 CAGAGCAGGAGGTGAGCAGTGGG + Intronic
1166654398 19:44599609-44599631 CAGTCTAGGAGAAGAGCAGAGGG + Intergenic
1167649409 19:50721244-50721266 TAGCCCAGGTGGTGAGCAGCTGG + Intergenic
1168420837 19:56202251-56202273 CAGTTCAGCTCCAGAGCAGTTGG + Intergenic
926043047 2:9690217-9690239 CTTTCCTGGTGGAGGGCAGTGGG + Intergenic
927514752 2:23665668-23665690 CACTCATGGTGGAGAGCAGAGGG + Intronic
927871288 2:26625673-26625695 AAGTCCGGGTGGGAAGCAGTGGG - Intronic
927976425 2:27342085-27342107 CTGTCCAGGTGGAGAAGAGGTGG - Exonic
928023583 2:27722250-27722272 CTGTCCAGGTGGGGAGCCATTGG - Intergenic
929069849 2:38019291-38019313 CACTCCTGGTGGGTAGCAGTGGG + Intronic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
929668449 2:43851726-43851748 CAGTCAAGTTGGGGAGCAGCTGG - Exonic
930900240 2:56497525-56497547 CAGTCATTGTGGAAAGCAGTTGG - Intergenic
931139198 2:59438426-59438448 CTGGCCAGGTATAGAGCAGTAGG - Intergenic
931777650 2:65554163-65554185 CAGTTGAGGTGGAGAGTGGTAGG + Intergenic
931995664 2:67837026-67837048 CAGAGCAGCTGGAGAGCACTGGG + Intergenic
934936425 2:98469167-98469189 CAGCTGGGGTGGAGAGCAGTGGG + Intronic
935232870 2:101114612-101114634 CAGTCCAGGATGAGATTAGTAGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937301404 2:120844915-120844937 AATTCCAGGTGGAGAACAGGAGG - Intronic
938058609 2:128234848-128234870 CAGGCCATGTGGAAAGCAGCAGG + Intergenic
942602238 2:177653198-177653220 CACTCCAGGTGCAGAGTCGTAGG + Intronic
943542778 2:189238808-189238830 GAAACCAGGTGGAGAGTAGTTGG - Intergenic
945478090 2:210309983-210310005 GAGAACAGGTGGAGAGAAGTGGG - Intronic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
948127158 2:235572600-235572622 AAGCCCAGGTGCAGAGAAGTGGG - Intronic
949060997 2:241957268-241957290 CAGTCATGGTGGAAGGCAGTGGG + Intergenic
1168909295 20:1433997-1434019 GAGTTCAGGTGGCAAGCAGTGGG - Intergenic
1169172150 20:3473478-3473500 CAGGCCAAGTGGAGATCTGTGGG + Intronic
1169831463 20:9830113-9830135 CTGTCCAGGTGCTGAGAAGTTGG + Intronic
1170742015 20:19066443-19066465 CAGTGCAGGAGGTGAGCAGCAGG + Intergenic
1171457520 20:25280460-25280482 CAGGCCAGGTGGGGGGCCGTTGG - Intronic
1172157558 20:32839225-32839247 CTTTCCAGATGGGGAGCAGTGGG + Intronic
1172775537 20:37404594-37404616 CAGTCCTGGTGCATGGCAGTGGG - Exonic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173048868 20:39539787-39539809 CACTCAAGGTGGAAAGCAGAAGG - Intergenic
1173862352 20:46292309-46292331 CAGCTCAGCTGGAGAGCAGAGGG - Intronic
1174157981 20:48528919-48528941 CAGTCCATGTGGACAGCAGAGGG + Intergenic
1174387011 20:50193291-50193313 CAGGCCAGGTGGAGAGAGGTGGG + Intergenic
1174903477 20:54525012-54525034 CTGTCCAGTGGGAGAGCAGGCGG + Intronic
1174962849 20:55177403-55177425 CTGTCCAGGTGAAATGCAGTGGG + Intergenic
1175309089 20:57999056-57999078 CAGACTAGGTGGAGAGAAGTTGG + Intergenic
1175903930 20:62370766-62370788 CTGTCCAGGCTGAGGGCAGTGGG - Intergenic
1176083957 20:63287473-63287495 CTGTCCAGGTGCAGAGCTCTCGG + Intronic
1176382438 21:6120097-6120119 CAGGCCCGGTGGAGAACAGGGGG - Intronic
1179739277 21:43409173-43409195 CAGCCCCGTTGGAGAGCAGCTGG + Intergenic
1179741034 21:43418142-43418164 CAGGCCCGGTGGAGAACAGGGGG + Intronic
1181278113 22:21699454-21699476 CACTCCTGGTGGAGGGCAGGTGG + Exonic
1181899340 22:26139804-26139826 TATTGCAGGTTGAGAGCAGTTGG - Intergenic
1182615544 22:31586720-31586742 TATTCAAGGTGGAGAGCAGAGGG + Intronic
1183728817 22:39605530-39605552 CAGGCCTTGTGCAGAGCAGTGGG + Intronic
949207196 3:1454366-1454388 CACACCAGGAGGTGAGCAGTGGG - Intergenic
949591336 3:5497162-5497184 GAGTCGAGGTGGAGTGCAGCTGG + Intergenic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
953849839 3:46457113-46457135 CAGACCAGGAGGTGAGCAGAGGG - Intronic
954653051 3:52177005-52177027 CAATCCTGCTGGAGAGCTGTGGG + Intergenic
955324570 3:58000288-58000310 CAGCCAAGGTGGAGATCAGAAGG - Intergenic
956934658 3:74086850-74086872 CACTCAAGTTGGAGAACAGTGGG + Intergenic
959131137 3:102357478-102357500 AACTCCAGGTGGGGATCAGTGGG + Intronic
959933098 3:112003602-112003624 CAGTCAAGGTAGAGAATAGTAGG - Intronic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
961671172 3:128532569-128532591 CAGGACAGGGGGTGAGCAGTAGG + Intergenic
962286549 3:134091139-134091161 CAGAGCAGGTGGTGAGCAGCAGG - Intronic
963181881 3:142366608-142366630 CAGTTAAGGAGGACAGCAGTAGG + Intronic
963376634 3:144474896-144474918 GAGTCAAGATGGTGAGCAGTGGG - Intergenic
963757888 3:149255220-149255242 CATTCCAGATGGAGAGAAGAGGG + Intergenic
963971004 3:151429437-151429459 CAGACCAGGAGGAGAGAAGAGGG + Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966007333 3:175031691-175031713 CAGTCATGGTGGAAAGCAGTTGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966728539 3:183130971-183130993 CTTTCCAGGTGGAGAGCAGAGGG - Intronic
967808749 3:193737411-193737433 CAGTCCAGGAGGAGAGAATGAGG - Intergenic
969113269 4:4856633-4856655 CAATCCAGGGGCAGAGCAATGGG + Intergenic
969376332 4:6765854-6765876 CATTCCAGGTGGAATGCAGGAGG - Intergenic
969477670 4:7430744-7430766 CAGCCCAGGAGAAGAGCAGCTGG - Intronic
969917529 4:10505246-10505268 CAGCCCGGGTGGAGAGCCGTGGG - Intronic
970904669 4:21202035-21202057 CAGCCCCTGTGGAGAGCAGTTGG + Intronic
970996785 4:22276862-22276884 CAGCCCCTGTGGAAAGCAGTTGG - Intergenic
973818996 4:54646009-54646031 CAGTGCAGTTGGAGAGCGCTGGG - Intergenic
974049185 4:56924502-56924524 CACTCAGGGTGGAGTGCAGTGGG + Intronic
974913786 4:68154769-68154791 CAGCACAGGCAGAGAGCAGTGGG + Intergenic
975563868 4:75733385-75733407 CAGTCACTGTAGAGAGCAGTTGG - Intronic
975815402 4:78211561-78211583 TAGTCCAGGTGAAGAGCCCTTGG - Intronic
977796507 4:101172062-101172084 AAGTACTGATGGAGAGCAGTGGG + Intronic
978055830 4:104264862-104264884 CATTGCAGTAGGAGAGCAGTGGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981182695 4:141764300-141764322 CAGAGCAGGAGGTGAGCAGTGGG - Intergenic
981738526 4:147978245-147978267 CAGCCCCTGTGGAAAGCAGTTGG - Intronic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
983606368 4:169590439-169590461 GAGTCTAGGTGGAGAGGAATGGG + Intronic
983777328 4:171624430-171624452 CAGCCCCTGTGGAAAGCAGTTGG + Intergenic
983921044 4:173345196-173345218 CAGCACAGGTAGAGAGCTGTAGG - Intergenic
985729729 5:1540398-1540420 CAGGGCAGGTGGAGAGCGGGAGG + Intergenic
985926934 5:3026294-3026316 CAGGCCAGGGGGAGTGCAGGAGG - Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986945158 5:13009232-13009254 CAGCCATGGTGGAAAGCAGTTGG + Intergenic
988589492 5:32536445-32536467 CACTGCAGGAGGTGAGCAGTGGG + Intronic
988658367 5:33237342-33237364 CAGTGCAGGTTGAGAGTAGAAGG + Intergenic
990912568 5:60867293-60867315 CACTCAGGGTGGAGTGCAGTGGG + Intergenic
991066204 5:62427524-62427546 CACTGCAGGAGGTGAGCAGTGGG + Intronic
991301551 5:65133603-65133625 CAGTCCAAGAGGAGAGAAATGGG - Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
993852079 5:93023184-93023206 CAGTCCCAATGGAGAGCAGCAGG - Intergenic
993852213 5:93024314-93024336 CAGAGCCGGAGGAGAGCAGTAGG + Intergenic
993909444 5:93663440-93663462 CAGCCTAGGAGGAGAGGAGTAGG + Intronic
993943252 5:94087363-94087385 CTGCCCAGGTGGAGTGCAGTGGG - Intronic
994753153 5:103763833-103763855 CAGGCAATGTGGAGAGCAGAGGG + Intergenic
995092529 5:108194885-108194907 CAGTCCAGGTTGAGATCAACTGG - Intronic
995151682 5:108854901-108854923 CAGCCCAGCTGGAGTGCAGTGGG - Intronic
997039898 5:130240514-130240536 CAGTCACTGTGGAAAGCAGTTGG - Intergenic
997530805 5:134580069-134580091 CAGTGCAGGTGGAGGGCTGTAGG + Exonic
997709394 5:135990952-135990974 CAGCGGAAGTGGAGAGCAGTGGG + Intergenic
997726562 5:136125692-136125714 CAGTCTAGGTAGGGTGCAGTGGG + Intergenic
997885813 5:137629055-137629077 CAGTACAGGAGGAGAGAAGTGGG - Intronic
1000771332 5:165358457-165358479 CAGCGCAGGAGGTGAGCAGTAGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1007508572 6:42357587-42357609 CAGTCAAGGTGATGAGCATTAGG + Intronic
1008100153 6:47381318-47381340 CAGTCCAGATGGAGAGATTTAGG + Intergenic
1008560834 6:52723068-52723090 GAGACCAGCTGGAGAGCAGAAGG + Intergenic
1008596196 6:53044191-53044213 CACAGCAGGAGGAGAGCAGTGGG + Intronic
1009644756 6:66383821-66383843 CAGTACAGGCACAGAGCAGTAGG + Intergenic
1014091747 6:117411679-117411701 CAGTTCATATGGAGGGCAGTGGG - Intronic
1015736457 6:136405460-136405482 CACTCTAGGTGGAGTGCATTTGG + Intronic
1016517740 6:144914211-144914233 CAGTCAAGGTGGAAAGCAAAAGG - Intergenic
1017209412 6:151838321-151838343 AAGGCCAGGTAGAGAGCAGCAGG + Intronic
1018798495 6:167205453-167205475 CAGGTCAGGTGCATAGCAGTGGG + Intergenic
1018957309 6:168418818-168418840 CAGGCCTGGAGGAGGGCAGTGGG - Intergenic
1020020605 7:4865120-4865142 CCAACCAGGTAGAGAGCAGTGGG - Intronic
1020241099 7:6395838-6395860 AAATCCAGGTGGATAGCATTTGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021448684 7:20760595-20760617 CAGAGCAGGAGGTGAGCAGTGGG + Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022884207 7:34625114-34625136 CAATCAAGTTGGAGTGCAGTGGG - Intergenic
1024548186 7:50539514-50539536 CAGCCCTGGTGGAGAACAGAAGG + Intronic
1024947838 7:54829000-54829022 CAGTCCAGTTGGACTGTAGTTGG - Intergenic
1027734785 7:81919678-81919700 CAAGCCAGGTGTGGAGCAGTAGG + Intergenic
1028832367 7:95341936-95341958 CATTCCTGGTGGTGGGCAGTGGG - Intergenic
1029476743 7:100789496-100789518 GAGACCAGGTGGAGAGCAGAGGG + Intronic
1031486268 7:122329740-122329762 CATTCCAGGTGGCAAGCAGCTGG - Intronic
1031578050 7:123439515-123439537 TATTCCATGTGGTGAGCAGTGGG - Intergenic
1031910880 7:127515650-127515672 CTGTCTAGGTGAAAAGCAGTGGG - Intergenic
1033531725 7:142270976-142270998 CAGTTTAGGAGGAGATCAGTAGG - Intergenic
1034297896 7:149990392-149990414 CAGTGCAGGGACAGAGCAGTGGG + Intergenic
1034808128 7:154106461-154106483 CAGTGCAGGGACAGAGCAGTGGG - Intronic
1034869490 7:154671304-154671326 GAGGCCAGGTGCAGAGCTGTGGG - Intronic
1036522315 8:9503012-9503034 CAACCCAGATGGAGAGCTGTAGG - Intergenic
1038417879 8:27410484-27410506 CAATCCTGGTGGAGGACAGTGGG + Intronic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1039476780 8:37842953-37842975 CAGTCCTGGGGGAGGGGAGTGGG + Exonic
1040706074 8:50129353-50129375 CTGTCCAGGTGGAATGCAGAAGG + Intronic
1041172433 8:55158090-55158112 CAGCCATTGTGGAGAGCAGTTGG - Intronic
1045064685 8:98435012-98435034 CAGTCCAGGTGGAGAGCAGTGGG - Intronic
1046030175 8:108774284-108774306 CAGTCCAGTTGGTTAGCATTTGG - Intronic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046389915 8:113557189-113557211 CAGACCATATGGAGACCAGTTGG + Intergenic
1047420831 8:124706961-124706983 CTGTCCAGAGGGACAGCAGTTGG + Intronic
1047489917 8:125365920-125365942 CAGGCAAGAGGGAGAGCAGTTGG - Intronic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049695859 8:143984020-143984042 CAGTACAGGTGGTGACCAGGAGG - Exonic
1050964975 9:11788383-11788405 CCTTCCAGGTGGAAAGCAGGTGG - Intergenic
1051807417 9:21010993-21011015 CATACCAGGAGGTGAGCAGTAGG - Intronic
1052849157 9:33365844-33365866 GACTACAGCTGGAGAGCAGTGGG + Intronic
1054867807 9:70020506-70020528 GAGTCCAGGTAGAGGGCAATGGG + Intergenic
1060033698 9:120236941-120236963 GGGTCCAGGTTGAGAGCAGGGGG - Intergenic
1060909884 9:127341063-127341085 CAGCCCAGCTGGAAAGCAGAGGG - Intronic
1060958545 9:127662730-127662752 AAGGCCAGGAGGAGAGCAGAAGG - Intronic
1186146286 X:6627393-6627415 CACTGCAGGAGGTGAGCAGTGGG + Intergenic
1187238928 X:17494962-17494984 CAGTTCAGCTCGAGAACAGTTGG + Intronic
1190165791 X:48071839-48071861 GAGGCCAGGTGGGGAGAAGTGGG - Intergenic
1194114016 X:89873612-89873634 CAGTGAAGGTGGGGAGCTGTGGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195683520 X:107565875-107565897 CATTCCATGTGCACAGCAGTTGG + Intronic
1198741038 X:139843002-139843024 CAGTCCAAGAGAACAGCAGTTGG - Intronic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1200115923 X:153769706-153769728 CGGCCCAGCTGGAGTGCAGTGGG - Intronic
1200119368 X:153783199-153783221 GAGTGCAGGTGGGGAGCGGTGGG - Intronic
1200376004 X:155781021-155781043 CATTCCAGATGGAGAGCTATAGG - Exonic