ID: 1045066865

View in Genome Browser
Species Human (GRCh38)
Location 8:98455686-98455708
Sequence TGCCCAGGTAAATTCCCAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045066865_1045066872 29 Left 1045066865 8:98455686-98455708 CCTTTTGGGAATTTACCTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1045066872 8:98455738-98455760 TAATTGTAGGGCAAAATCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 162
1045066865_1045066869 17 Left 1045066865 8:98455686-98455708 CCTTTTGGGAATTTACCTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1045066869 8:98455726-98455748 TTGACCTCTGCCTAATTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1045066865_1045066868 16 Left 1045066865 8:98455686-98455708 CCTTTTGGGAATTTACCTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1045066868 8:98455725-98455747 TTTGACCTCTGCCTAATTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045066865 Original CRISPR TGCCCAGGTAAATTCCCAAA AGG (reversed) Exonic
901457393 1:9371142-9371164 TTCCCAGGTAAAGTCTCCAAAGG + Intergenic
901886300 1:12225648-12225670 TGCCCACGTAAAAACCCTAAAGG - Intergenic
902106639 1:14042193-14042215 TGCTGAGGAAATTTCCCAAAAGG - Intergenic
902112203 1:14091147-14091169 TGCACAGGTAAATTTGTAAAGGG - Intergenic
904682008 1:32235673-32235695 TCCCCAGGTACTTTCTCAAAGGG - Intergenic
906934963 1:50206660-50206682 ACCCCAGGTTAATTCCCAGAAGG + Intergenic
906939898 1:50246575-50246597 TGCACTGGTACAGTCCCAAATGG - Intergenic
907242141 1:53086671-53086693 TGCCCAGGGACATTTCCAGATGG - Intergenic
916383825 1:164244504-164244526 TGTCCAGTTGAATTCCCACAGGG + Intergenic
924254165 1:242165852-242165874 TTCCCAGGTAAATGCCTGAATGG - Intronic
1065795421 10:29303114-29303136 TGCACAGGTAAATTTCCACAGGG - Intronic
1067907478 10:50308739-50308761 TTCTCAGGTAATTTCCCAAATGG - Intronic
1068517570 10:58043457-58043479 TGCGCAGGAAAATTACAAAAAGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1071135902 10:82454107-82454129 TGCCCAGATCAATTGCCAGATGG + Intronic
1072183591 10:93012721-93012743 AGCTCAGATAAATTCACAAATGG + Intronic
1073844772 10:107542846-107542868 TGCGCTGGTAAATACGCAAAGGG - Intergenic
1076776439 10:132700461-132700483 TTCCCTGGTAAATTAACAAAAGG + Intronic
1079460678 11:20675347-20675369 AGCCCAGGAAACTTTCCAAAAGG - Intronic
1079806375 11:24935330-24935352 AGCCCAGGCAACTTCACAAAGGG - Intronic
1082773952 11:57231466-57231488 TGCCGTCGTAAATTCCCAAAGGG + Intergenic
1082915929 11:58437121-58437143 TGCCAATGTAAATTACCAATTGG + Intergenic
1086873218 11:92064179-92064201 TGCCCAGGTAATTGCAAAAATGG - Intergenic
1086989840 11:93290845-93290867 TGCATAGGTAATTTACCAAATGG - Intergenic
1087800149 11:102495109-102495131 TCCCCAGTTAAAGTTCCAAAAGG + Intronic
1089710585 11:120311662-120311684 TGCCCAAGGACATTCCCACATGG - Intronic
1089894962 11:121920941-121920963 TGCCTAGATAAATCCCCAGATGG - Intergenic
1090140087 11:124248593-124248615 TGCCAAAGTAAAATTCCAAATGG - Intergenic
1090362037 11:126179894-126179916 TCTTCAGGTGAATTCCCAAAGGG - Intergenic
1099692610 12:85978369-85978391 TACCCATTTAAATTCCAAAAAGG + Exonic
1101073332 12:101099571-101099593 TGCCCAGGTTAATTCAGAATTGG + Exonic
1103825382 12:123733665-123733687 TTCCCAGGTAAAGTCCAACAAGG - Intronic
1104464799 12:128981687-128981709 AGCCCATGTAAATTCCAAGAAGG - Intronic
1108463901 13:50695266-50695288 AGCCCAGGAAAATACACAAATGG + Intronic
1111803274 13:93005961-93005983 TGCCCAGGCAGAATCCCTAAAGG - Intergenic
1116081441 14:40178719-40178741 TGCCAAGACCAATTCCCAAAAGG + Intergenic
1119946854 14:78704327-78704349 TAGCCAGGGAAATTCTCAAATGG + Intronic
1120472083 14:84938418-84938440 TACCCAGCAATATTCCCAAATGG - Intergenic
1122509468 14:102254803-102254825 TGCTCAGGTGAATTCCCTCATGG + Intronic
1122998631 14:105279695-105279717 TTCGCAGGTAAACTCCCAAGCGG + Intronic
1124650802 15:31472441-31472463 TCCCCAGGGAGCTTCCCAAAAGG + Intergenic
1127510465 15:59635712-59635734 TGGGCAGGGAAATTCTCAAAAGG - Intronic
1127574134 15:60273511-60273533 TGCCCTGGAAAATTCACACATGG + Intergenic
1130738558 15:86574405-86574427 TGACCAGTCAAATTCCTAAAAGG - Intronic
1130853270 15:87818997-87819019 TGCCCTTCCAAATTCCCAAAAGG + Intergenic
1135646448 16:24166628-24166650 GGGCCAGATAAATTTCCAAACGG - Intronic
1137936867 16:52643103-52643125 GGACAAGGTAATTTCCCAAAAGG - Intergenic
1138497798 16:57418902-57418924 TGCTCAGGTGAATTCCACAAGGG + Intergenic
1139599299 16:67976948-67976970 TGGGCAGGAAAAGTCCCAAAGGG - Intronic
1141101604 16:81201522-81201544 ATCCTAGTTAAATTCCCAAAAGG + Intergenic
1142311939 16:89319319-89319341 TGCCCAGGCACCTTCCCCAATGG + Intronic
1143256563 17:5562065-5562087 TGCCCAGGGAAACACCCAGATGG + Intronic
1146247354 17:31300512-31300534 AGCCATGGTACATTCCCAAATGG - Intronic
1148130357 17:45258410-45258432 TGCCCAGGGAAATTCTGTAAAGG - Intronic
1148956035 17:51354399-51354421 TACCCAGGTAAATTCCAGACAGG - Intergenic
1149295866 17:55262393-55262415 TCCACAGGTTAATTCTCAAATGG - Intergenic
1150698841 17:67429933-67429955 TGCACAGGTTCATTGCCAAATGG - Intronic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1156038000 18:32787840-32787862 TGCACAGTTAATTTTCCAAAGGG - Intergenic
1158473059 18:57755667-57755689 TACACAGGCAAACTCCCAAAGGG + Intronic
1160021176 18:75183078-75183100 TGCCCAGTGACATTCCTAAATGG - Intergenic
1165001090 19:32763237-32763259 TGCCCAATTAAAATCACAAATGG - Intronic
1166515916 19:43446873-43446895 TGCCAAGGTTCTTTCCCAAATGG + Intergenic
927626196 2:24721585-24721607 TGCCCAGGGAATCTCCCAAAGGG - Intronic
929818416 2:45254681-45254703 TGCTCAGGATAATTTCCAAAGGG + Intergenic
931883592 2:66592029-66592051 TGACCAGGAAAATTCACCAAAGG - Intergenic
932919056 2:75888993-75889015 TGCCCAAGTAATTCCCCTAAAGG - Intergenic
933406560 2:81867183-81867205 TGCCCAGGAAAAATCTCTAATGG - Intergenic
937966501 2:127515525-127515547 TCCCCAGTTTAAATCCCAAAGGG - Intronic
939276038 2:139997202-139997224 TGCTGAGGAAAATTCCAAAAAGG - Intergenic
942241865 2:173970266-173970288 TGCCCAGGTAACTGATCAAAGGG + Intergenic
942654171 2:178197174-178197196 TGCCAAATTATATTCCCAAATGG + Intronic
943116555 2:183679090-183679112 TGCCCAGGTTAATTACCTACAGG + Intergenic
943820165 2:192312308-192312330 TGCCTAGATAAATTCCTGAAAGG + Intergenic
947027999 2:225760644-225760666 TGCCCATGTAATTGCCCAACAGG + Intergenic
947157167 2:227174370-227174392 TGGCCAAGTAAATTCCAAAAAGG + Intronic
948544234 2:238715105-238715127 TGCCAAGTTAATTTCCAAAATGG + Intergenic
1172789817 20:37495138-37495160 TGCCCAGGTGAAATCCTAGATGG - Intronic
1174541823 20:51295932-51295954 TGCCCAGATGATTTCCCAAAAGG + Intergenic
1180235168 21:46454611-46454633 TCCCCAGGTACTTTTCCAAAGGG - Intergenic
1184966934 22:47983542-47983564 TGCCCAGGAAAATTGACAACAGG - Intergenic
949594856 3:5532673-5532695 TGCCCTGGGAAATACCCAGATGG - Intergenic
950155029 3:10715617-10715639 TGCACAGGTAAACTCCAGAAAGG + Intergenic
950692401 3:14670345-14670367 TGTCCAGGGAAATTCCCCAATGG - Intronic
952190715 3:31020418-31020440 TCACCAGGTAAACTCCAAAAAGG + Intergenic
955623686 3:60893765-60893787 TGCCCAGGTGGTTTCCCAGATGG - Intronic
955623988 3:60896638-60896660 TGCCCAGGTGGTTTCCCAGATGG - Intronic
957897388 3:86440647-86440669 TGGACATGCAAATTCCCAAAAGG + Intergenic
960204069 3:114873767-114873789 TTTCCAGCCAAATTCCCAAAGGG + Intronic
962473201 3:135731859-135731881 TGTCCTGGGAAATACCCAAATGG - Intergenic
963072554 3:141316707-141316729 TGCTCAGATGAATTCCTAAAGGG - Intergenic
964404413 3:156334153-156334175 TGCCAAAATAAATTCCAAAACGG - Intronic
967150711 3:186646749-186646771 TGCCAAGTTAAATTCCCACCAGG - Intronic
975430096 4:74279492-74279514 TTCCCAGGAAAATTACAAAATGG - Intronic
977316728 4:95459056-95459078 AACCCAGGAAAATTCCTAAAAGG - Intronic
979365114 4:119813123-119813145 TGTGCATGTAAATTCCCAATTGG + Intergenic
981423980 4:144582369-144582391 TGCACATATATATTCCCAAATGG + Intergenic
984189239 4:176585102-176585124 TGCCAAAATAAATTCCCAGATGG - Intergenic
984663672 4:182402125-182402147 AGCCCAGGGAAATTAGCAAATGG - Intronic
989543583 5:42646464-42646486 TACCCAGGTAAATAAGCAAAAGG + Intronic
990948577 5:61274841-61274863 TGCTCAGGTTAATTCTGAAATGG + Intergenic
996714903 5:126579310-126579332 AGCCAAGGTAAGGTCCCAAATGG - Intronic
997648364 5:135496798-135496820 TGCCCAGGAAGATTCCTAAATGG - Intergenic
997689867 5:135821175-135821197 TGCCCAGGGAAGTTCCCATGTGG - Intergenic
998042385 5:138959881-138959903 TGCCTAGGTCAAATCCCTAAAGG + Intronic
999378244 5:151101734-151101756 TGCACAGGTCAGATCCCAAAGGG - Intronic
999808870 5:155109154-155109176 TGGTGTGGTAAATTCCCAAAAGG + Intergenic
1001392408 5:171389671-171389693 TACCTACCTAAATTCCCAAATGG - Intronic
1002197817 5:177510614-177510636 TGGCCAAGTGCATTCCCAAATGG - Intronic
1003605638 6:7558175-7558197 TGCCCAGGCCAATGACCAAATGG + Exonic
1004744735 6:18498580-18498602 GGCCCAGGGACATTCCCTAATGG + Intergenic
1013456685 6:110335997-110336019 TTCCCAGGTAAAAACCAAAATGG + Intronic
1015002600 6:128237279-128237301 TGGTCAGGTAAAATACCAAATGG - Intronic
1016727135 6:147384976-147384998 TGACCTGTTTAATTCCCAAATGG - Intronic
1021230739 7:18084455-18084477 TGTCCAGGTCATTTCACAAATGG - Intergenic
1021657651 7:22887902-22887924 ATCCCAAGTAAATTTCCAAATGG - Intergenic
1027111333 7:75442332-75442354 TGCCCAGGTAACTGCCCATGAGG + Intronic
1027283574 7:76626891-76626913 TGCCCAGGTAACTGCCCATGAGG + Exonic
1028605678 7:92652858-92652880 AGCTCAGGTAAATGCCCAATGGG + Intronic
1029298353 7:99559038-99559060 GGCCAAGGCAAAGTCCCAAAAGG - Intronic
1030765661 7:113406153-113406175 AGCCAGTGTAAATTCCCAAAGGG + Intergenic
1033231507 7:139601904-139601926 AGTCCATGTAAATGCCCAAAAGG - Intronic
1041486232 8:58379761-58379783 TGCCCAGGGGAATTACCAGAAGG - Intergenic
1045066865 8:98455686-98455708 TGCCCAGGTAAATTCCCAAAAGG - Exonic
1045296859 8:100878979-100879001 TGCCCAGTTAAATTCAAAATGGG - Intergenic
1045555490 8:103210614-103210636 AGCCCAGGCAAATACCCCAAAGG + Intronic
1048170594 8:132102549-132102571 TGCGCAGGTAAAGTGCCACACGG - Intronic
1049837779 8:144749613-144749635 TGCTCAGGTAAACCCACAAAAGG - Intronic
1055448825 9:76411628-76411650 TGCTCAAGTAAAATCACAAATGG - Intergenic
1055835264 9:80432526-80432548 TGTCAAGTTAAGTTCCCAAAAGG + Intergenic
1059708485 9:116845466-116845488 AGATCAGGTAAATTCCCAGAGGG + Intronic
1062681730 9:137785603-137785625 TGACAAGCTAAATTCTCAAAAGG - Intronic
1190499481 X:51060464-51060486 TGCCCAGGTCAATTTCCCATGGG - Intergenic
1194404154 X:93473620-93473642 TGCCAAGGTCAATGTCCAAAAGG - Intergenic
1194884710 X:99299390-99299412 TGCCCAGTTTTATTCTCAAAGGG - Intergenic
1197927316 X:131660436-131660458 TTCCTAGGTAAATTCTCCAATGG - Intergenic
1199433172 X:147783497-147783519 TGCCAAACTATATTCCCAAATGG - Intergenic
1199613009 X:149633651-149633673 TGACAAGGTAAATTGCCAAGAGG + Intergenic
1202336477 Y:23816542-23816564 AGGCCAGGTAAATTCATAAAAGG - Intergenic
1202534289 Y:25853525-25853547 AGGCCAGGTAAATTCATAAAAGG + Intergenic