ID: 1045070908

View in Genome Browser
Species Human (GRCh38)
Location 8:98503954-98503976
Sequence CAATATTAGATCAACAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 4, 2: 6, 3: 16, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045070908_1045070912 15 Left 1045070908 8:98503954-98503976 CCTGTCTTGTTGATCTAATATTG 0: 1
1: 4
2: 6
3: 16
4: 165
Right 1045070912 8:98503992-98504014 AGTCTCCCATTATTACTGTGTGG 0: 81
1: 5982
2: 3770
3: 2324
4: 1485
1045070908_1045070913 16 Left 1045070908 8:98503954-98503976 CCTGTCTTGTTGATCTAATATTG 0: 1
1: 4
2: 6
3: 16
4: 165
Right 1045070913 8:98503993-98504015 GTCTCCCATTATTACTGTGTGGG 0: 86
1: 5971
2: 3582
3: 2062
4: 1293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045070908 Original CRISPR CAATATTAGATCAACAAGAC AGG (reversed) Intronic
900833728 1:4984379-4984401 CAATATTCTAGCAACAAAACAGG + Intergenic
902759583 1:18572436-18572458 CAATATTTGCTGAACAAGAGAGG + Intergenic
903163280 1:21504163-21504185 CAGTATTAGAGGAACAAGCCCGG + Intergenic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG + Intronic
907684241 1:56594553-56594575 CAAAATTAAATTAACAACACTGG - Intronic
907792981 1:57685487-57685509 CAGTGTTAGATCAACAAGGTAGG + Intronic
913956520 1:143302395-143302417 AAATATTAGATGATCAAGAAGGG - Intergenic
913980924 1:143513271-143513293 AAATATTAGATGATCAAGAAGGG + Intergenic
914075285 1:144339700-144339722 AAATATTAGATGATCAAGAAGGG + Intergenic
914103893 1:144626796-144626818 AAATATTAGATGATCAAGAAGGG - Intergenic
917362604 1:174193552-174193574 CAATATTAGTTTAAGGAGACAGG - Intronic
917520396 1:175743443-175743465 CAAAATAAGATCAAAAAGTCAGG + Exonic
918649457 1:186943159-186943181 CAATTTTACTTCAACAATACCGG + Intronic
919241076 1:194917317-194917339 CAATATTAGATCCTCAATATTGG - Intergenic
920447045 1:206025422-206025444 CAGTGAAAGATCAACAAGACGGG - Intergenic
921029057 1:211321037-211321059 CAATAATAGAACAAAAAGAGCGG + Intergenic
922747955 1:228057531-228057553 GGATATTAGATAAACTAGACTGG + Intronic
923651457 1:235877936-235877958 AAATATAATATCAAGAAGACAGG + Intronic
924292151 1:242547641-242547663 CAATATTACATTGACAAGAATGG - Intergenic
1064268599 10:13845752-13845774 GAAAATTAGAGCAGCAAGACAGG + Intronic
1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG + Intronic
1066781655 10:38954866-38954888 AAATATTAGATGATCAAGAATGG + Intergenic
1068292162 10:55017308-55017330 CTATATTAGAACAGCAAGAGGGG - Intronic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1071157208 10:82704908-82704930 GAATATTACATCAAGAAGGCAGG + Intronic
1071262171 10:83930263-83930285 CATTATTAGATCACCAAAAGGGG + Intergenic
1074651098 10:115525309-115525331 CATAATTAGATCAACAAGATTGG - Intronic
1075788956 10:125069679-125069701 CAATATTAAATCCCCAAGCCAGG + Intronic
1079513637 11:21240614-21240636 CAATAGTACATTAACAAGATTGG + Intronic
1080454193 11:32403444-32403466 CAACAGTTGATCAACATGACTGG + Intronic
1080735334 11:35008565-35008587 CAATATTAGATGAAGCAAACGGG + Intronic
1081067927 11:38570657-38570679 AACTATTAGATCAAACAGACCGG + Intergenic
1081301604 11:41459190-41459212 AAATGTTAGATAAACAAGAGAGG + Intronic
1081512171 11:43786858-43786880 TAATATTCTACCAACAAGACAGG - Intronic
1082888132 11:58109930-58109952 GAATGTTAGACCATCAAGACTGG + Intronic
1083478983 11:62931454-62931476 AAATATTGGATAGACAAGACTGG - Intergenic
1084970644 11:72770002-72770024 CAAGATTAAATAAACAAAACAGG + Intronic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1091514981 12:1170154-1170176 CACTATTACATGAATAAGACAGG - Intronic
1092570605 12:9717112-9717134 GAAAATTAGTTCAACAAGACTGG + Intronic
1093115803 12:15209418-15209440 CATTATTAGATCATAAGGACAGG + Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095898676 12:47305778-47305800 CAACATTTGAGCACCAAGACAGG + Intergenic
1098092879 12:66922839-66922861 GAAAAGTAGATCAAAAAGACAGG + Intergenic
1099065629 12:77974751-77974773 CAATATTAGAGGAAGAACACTGG - Intronic
1099300422 12:80887676-80887698 CAATATCAGAGTGACAAGACTGG - Intronic
1099329017 12:81257665-81257687 CAATTTTATATAAACAAAACTGG - Exonic
1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG + Intergenic
1107865430 13:44698718-44698740 CCATTTTAGATCAACCAGAAAGG - Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1109683178 13:65779845-65779867 CAATATTAAAGAAACAATACTGG - Intergenic
1110641739 13:77832276-77832298 CAATATTAACTCAACAATAGAGG - Intergenic
1111037639 13:82699516-82699538 CAATATTAGTACAACAATAATGG - Intergenic
1115759393 14:36563066-36563088 CATTTTAAGATCAACAAGAGGGG + Intergenic
1117122370 14:52581841-52581863 CTATTTTAGATCAACAAAAGAGG + Intronic
1117256350 14:53981766-53981788 CAATATTGAATCAATGAGACTGG - Intergenic
1117477775 14:56114841-56114863 CAATATTAAATTAAAAAGGCAGG + Intergenic
1122459896 14:101885874-101885896 TAATTTTAGGTCAAGAAGACTGG - Intronic
1202938934 14_KI270725v1_random:124071-124093 AAATATTAGATGATCAAGAAGGG - Intergenic
1123394205 15:19912206-19912228 AAATATTAGATGATCAAGAAGGG + Intergenic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1127317599 15:57812691-57812713 CAATATTAGATCAACCATACAGG - Intergenic
1131311236 15:91292308-91292330 CCACATTAGATGAACAGGACTGG - Intronic
1131533932 15:93218054-93218076 CAATATTAGGTCACAAGGACAGG - Intergenic
1131902980 15:97108970-97108992 AAATATTAGATCAATAAGACAGG + Intergenic
1134230692 16:12426965-12426987 ACATATTAGATCTACAATACTGG - Intronic
1136767426 16:32797368-32797390 AAATATTAGATGATCAAGAAGGG - Intergenic
1136800722 16:33073333-33073355 AAATATTAGATGATCAAGAAGGG + Intergenic
1136863689 16:33722535-33722557 AAATATTAGATGATCAAGAAGGG - Intergenic
1136868853 16:33783256-33783278 AAATATTAGATGATCAAGAAGGG + Intergenic
1136958622 16:34817049-34817071 AAATATTAGATGATCAAGAAGGG + Intergenic
1136984926 16:35093162-35093184 AAACATTAAATAAACAAGACAGG - Intergenic
1137085556 16:36117670-36117692 AAATATTAGATGATCAAGAAGGG - Intergenic
1137243488 16:46680930-46680952 AAACATTAAATAAACAAGACAGG + Intronic
1138367557 16:56493593-56493615 CAAAGTTAGATCTATAAGACAGG - Intronic
1138534276 16:57651705-57651727 CAATATCAGATCATGAAGACTGG + Intronic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1142213463 16:88819513-88819535 CAAGATTAAAGCAACAAGCCAGG - Intronic
1203069820 16_KI270728v1_random:1059390-1059412 AAATATTAGATGATCAAGAAGGG - Intergenic
1203103321 16_KI270728v1_random:1332812-1332834 AAATATTAGATGATCAAGAAGGG - Intergenic
1203125173 16_KI270728v1_random:1570681-1570703 AAATATTAGATGATCAAGAAGGG - Intergenic
1142647455 17:1323972-1323994 CAAAATTGGATCAACAGCACTGG + Intergenic
1144119052 17:12132177-12132199 CCATATTAGATCAGCTATACTGG - Intronic
1144395296 17:14837407-14837429 CAATTTTTGGTCAAAAAGACGGG + Intergenic
1145710911 17:26975304-26975326 AAATATTAGATGATCAAGAAGGG + Intergenic
1151039172 17:70838927-70838949 CAATATTAGGTCAACTTGATTGG + Intergenic
1203182330 17_KI270729v1_random:72167-72189 AAATATTAGATAATCAAGAAGGG + Intergenic
1153102244 18:1486908-1486930 TAATCATAGATCAGCAAGACTGG - Intergenic
1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG + Intergenic
1153203752 18:2673984-2674006 CAAAATAAGTTCAAAAAGACAGG - Intronic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1157107281 18:44786312-44786334 CAATATTAAACCAAAAAGCCTGG - Intronic
1157638392 18:49186012-49186034 CATTAATAGATCACAAAGACAGG - Intronic
1159497151 18:69221460-69221482 CTATAGCACATCAACAAGACAGG + Intergenic
1160247949 18:77175410-77175432 CACTAATAGACCAACAAAACTGG - Intergenic
1162210271 19:9085899-9085921 CCATTTTTGATCAACAAAACTGG - Intergenic
1166903492 19:46086214-46086236 CAATATTAGAAAAACAATTCGGG - Intergenic
927784825 2:25966404-25966426 CAATATAAGAGCAGCTAGACAGG - Intronic
927992697 2:27459441-27459463 ATATATTAGATCTACAGGACCGG - Exonic
929291703 2:40199525-40199547 CAATACTAGATCAAAAAGGAAGG + Intronic
934252788 2:90375814-90375836 AAATATTAGATGATCAAGAAGGG - Intergenic
934256653 2:91427133-91427155 AAATATTAGATGATCAAGAAGGG + Intergenic
935604126 2:104953047-104953069 CAATAATAGAACAAAAAGAGAGG + Intergenic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
937442468 2:121928540-121928562 CAATATAACATGAACAAAACAGG + Intergenic
938517244 2:132025122-132025144 AAATATTAGATGATCAAGAAGGG - Intergenic
940518420 2:154712028-154712050 CTATATTAGATCTAGAAAACAGG - Intronic
941684481 2:168434420-168434442 TAATATTAGATCAGCACGATAGG + Intergenic
946921044 2:224582768-224582790 CAATATTAGCTCCAAAAGGCAGG + Intronic
948187606 2:236033974-236033996 CATTATGAGATCAACTCGACAGG - Intronic
948496666 2:238354561-238354583 CAATTTTAGAACACCACGACTGG + Intronic
1170516264 20:17133478-17133500 CTATATAAGTTCCACAAGACAGG + Intergenic
1173566826 20:44045795-44045817 AAATATTAAATCACCAAGTCAGG + Intronic
1175559835 20:59913288-59913310 CAATATTAGAACAGGAAGAGAGG + Intronic
1176584321 21:8563458-8563480 AAATATTAGATGATCAAGAAGGG + Intergenic
1180267133 22:10540362-10540384 AAATATTAGATGATCAAGAAGGG + Intergenic
1180720584 22:17905170-17905192 CAATCTTACATCAACAGGAGAGG + Intronic
1184420041 22:44374500-44374522 CAATATCAGTTCAAAAACACAGG + Intergenic
1203288297 22_KI270735v1_random:5384-5406 AAATATTAGATGATCAAGAAGGG - Intergenic
1203326125 22_KI270738v1_random:21291-21313 AAATATTAGATGATCAAGAAGGG - Intergenic
950948190 3:16972548-16972570 CAATGTTAGATCATCAAGGCAGG - Intronic
954723057 3:52582270-52582292 CAATATTATATGACCAAGACAGG - Intronic
954916951 3:54156560-54156582 CAATATAAGAACATGAAGACCGG - Intronic
959842626 3:110995976-110995998 CTATATAAGACCAACATGACAGG + Intergenic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
963966704 3:151380010-151380032 CACTATTAGATAAATAAGAGAGG - Intronic
964553828 3:157914013-157914035 CAATATTTGAAGAAGAAGACTGG - Intergenic
965068876 3:163890966-163890988 CAATCTTACATCAAGAAGATAGG + Intergenic
965356468 3:167680330-167680352 TAAAATTAGATCAACAAGAATGG + Intergenic
966502484 3:180658673-180658695 CAACATTTTATCAACAAAACTGG - Intronic
971035236 4:22685693-22685715 TTATTTTAGATCAACTAGACTGG - Intergenic
971094738 4:23387921-23387943 CAAAATTAGGTCCCCAAGACTGG - Intergenic
973158680 4:46990663-46990685 CAATATTATATCAATAAAAGAGG - Intronic
974142190 4:57901046-57901068 CAATCTTTTATCAACAAAACTGG + Intergenic
975426019 4:74228786-74228808 CTATATAAAATAAACAAGACAGG + Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
978712617 4:111803338-111803360 AAATATTTGATTAATAAGACTGG + Intergenic
989830051 5:45905123-45905145 CAATATCTGATTAATAAGACAGG + Intergenic
991213969 5:64140154-64140176 CAATAATAGAAAAACCAGACAGG + Intergenic
993436295 5:87899828-87899850 CACTCTTAGAACAAAAAGACTGG - Intergenic
995049254 5:107683914-107683936 CAATCTTAGAGCAAGAAGACAGG + Intergenic
995907192 5:117139612-117139634 CAATTTTATATCAACAATACAGG - Intergenic
996139069 5:119882691-119882713 AAAAATTAGATCAACAAATCTGG - Intergenic
1000246612 5:159453553-159453575 CAATATTGAATTAATAAGACTGG + Intergenic
1003261293 6:4518543-4518565 CTATTTTTGAACAACAAGACAGG + Intergenic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1004657174 6:17674466-17674488 CAATATTAAATCAAAACTACTGG + Intronic
1005698477 6:28374881-28374903 CAATTTTAAATCAATAAAACAGG - Intergenic
1006281403 6:33056765-33056787 CAATGTTGGATCAAAAAGACTGG - Intergenic
1007524514 6:42480231-42480253 CAATAATAAATCAACAAGGGTGG + Intergenic
1007710020 6:43816938-43816960 CAATATTTCAGCAAAAAGACAGG + Intergenic
1009626274 6:66141867-66141889 CACCATTAGAGAAACAAGACTGG - Intergenic
1012032974 6:94096792-94096814 CACTAATAGATAAACAAGATGGG + Intergenic
1014038484 6:116796348-116796370 GAATATTAGATTTAAAAGACAGG + Intronic
1014141047 6:117942669-117942691 CAATATTTGACCAAGAAGTCTGG - Intronic
1019372908 7:672446-672468 CAAAATTGGTTCAACAAGGCCGG - Intronic
1019841610 7:3451673-3451695 CAATATTTGATTAACAATACAGG + Intronic
1020475155 7:8585545-8585567 CAATGTAAGAGCAGCAAGACTGG - Intronic
1021215099 7:17906370-17906392 AAATAATAGATCAACAACTCTGG + Intronic
1021477911 7:21083683-21083705 CAATATCAAATCTACAAGAGAGG + Intergenic
1024412709 7:49064386-49064408 CAATTTTAGATAAATAAGAAGGG - Intergenic
1024807537 7:53162602-53162624 AAATATTAGATGATCAAGAAGGG - Intergenic
1025306336 7:57862024-57862046 AAATATTAGATGATCAAGAAGGG - Intergenic
1025482822 7:61005439-61005461 AAATATTAGATGATCAAGAAGGG + Intergenic
1025562947 7:62393274-62393296 AAATATTAGATGATCAAGAAGGG + Intergenic
1025564174 7:62410699-62410721 AAATATTAGATGATCAAGAAGGG + Intergenic
1025877362 7:65495363-65495385 AAATATTAGATGATCAAGAAGGG - Intergenic
1028652703 7:93169145-93169167 CAATATTAGAGAAAAAAGAATGG - Intergenic
1032105261 7:129023509-129023531 CAATATTAAATACACAAGATGGG + Intronic
1032824137 7:135552691-135552713 CAATAATGGATCAATTAGACTGG + Intergenic
1039664251 8:39505646-39505668 GAAAAATAGATCAACAAAACAGG + Intergenic
1043069516 8:75620866-75620888 CCAAATTAGCTCAACAAAACTGG - Intergenic
1044554414 8:93546843-93546865 AACTATTAGATCATCAAGTCTGG - Intergenic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1045801841 8:106110864-106110886 CAAAATTATACCAACAAGAAAGG + Intergenic
1046698079 8:117365085-117365107 CATTATTAGGTCAACACAACTGG - Intergenic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1052356217 9:27507357-27507379 CAATATGACAATAACAAGACTGG - Intronic
1056077789 9:83059324-83059346 CAATCTTTGAACACCAAGACTGG + Intronic
1056418322 9:86399370-86399392 TAAAATTAAATCAACAAGAATGG - Intergenic
1203614224 Un_KI270749v1:40988-41010 AAATATTAGATGATCAAGAAGGG + Intergenic
1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG + Intronic
1188015516 X:25103871-25103893 TAATTTTAGGTCAACTAGACCGG - Intergenic
1189385491 X:40533769-40533791 CAATATTAGATAAAATAGGCCGG + Intergenic
1192060956 X:67825326-67825348 AAATATTATATCCAAAAGACAGG + Intergenic
1195990542 X:110677987-110678009 CTATATTAAATCAATGAGACGGG - Intronic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1196726683 X:118902080-118902102 GAAAATTAGATCAACAAAAATGG - Intergenic
1197867947 X:131038460-131038482 CAATCTTAAAACAATAAGACAGG - Intergenic
1199277253 X:145960867-145960889 CAATTTTAGGTCAAGAATACAGG + Intergenic