ID: 1045071929

View in Genome Browser
Species Human (GRCh38)
Location 8:98515338-98515360
Sequence ACTAGTCTGTTCAGCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045071927_1045071929 5 Left 1045071927 8:98515310-98515332 CCTAGGTTACTACTGCATCATAT 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1045071929 8:98515338-98515360 ACTAGTCTGTTCAGCAGACATGG No data
1045071926_1045071929 8 Left 1045071926 8:98515307-98515329 CCACCTAGGTTACTACTGCATCA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1045071929 8:98515338-98515360 ACTAGTCTGTTCAGCAGACATGG No data
1045071925_1045071929 14 Left 1045071925 8:98515301-98515323 CCTTTACCACCTAGGTTACTACT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1045071929 8:98515338-98515360 ACTAGTCTGTTCAGCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045071929 Original CRISPR ACTAGTCTGTTCAGCAGACA TGG Intronic
No off target data available for this crispr