ID: 1045096305

View in Genome Browser
Species Human (GRCh38)
Location 8:98801036-98801058
Sequence AGCCAGCTGGGTTCCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045096297_1045096305 12 Left 1045096297 8:98801001-98801023 CCACCCGTGGCCCTGGCATGGGA 0: 2
1: 5
2: 15
3: 53
4: 273
Right 1045096305 8:98801036-98801058 AGCCAGCTGGGTTCCTGTGTTGG No data
1045096301_1045096305 2 Left 1045096301 8:98801011-98801033 CCCTGGCATGGGATTCACTAGGC 0: 1
1: 10
2: 21
3: 64
4: 172
Right 1045096305 8:98801036-98801058 AGCCAGCTGGGTTCCTGTGTTGG No data
1045096302_1045096305 1 Left 1045096302 8:98801012-98801034 CCTGGCATGGGATTCACTAGGCG 0: 1
1: 5
2: 26
3: 60
4: 185
Right 1045096305 8:98801036-98801058 AGCCAGCTGGGTTCCTGTGTTGG No data
1045096299_1045096305 8 Left 1045096299 8:98801005-98801027 CCGTGGCCCTGGCATGGGATTCA 0: 1
1: 2
2: 19
3: 40
4: 267
Right 1045096305 8:98801036-98801058 AGCCAGCTGGGTTCCTGTGTTGG No data
1045096298_1045096305 9 Left 1045096298 8:98801004-98801026 CCCGTGGCCCTGGCATGGGATTC 0: 1
1: 2
2: 12
3: 56
4: 236
Right 1045096305 8:98801036-98801058 AGCCAGCTGGGTTCCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045096305 Original CRISPR AGCCAGCTGGGTTCCTGTGT TGG Intronic
No off target data available for this crispr