ID: 1045098695

View in Genome Browser
Species Human (GRCh38)
Location 8:98825229-98825251
Sequence GCCTGACCTCCCGGGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045098695_1045098709 21 Left 1045098695 8:98825229-98825251 CCTCCCGCCCCGGGAGGTCAGGC 0: 1
1: 0
2: 2
3: 26
4: 322
Right 1045098709 8:98825273-98825295 CACCCGACTTTCCACGCGCCAGG No data
1045098695_1045098703 -9 Left 1045098695 8:98825229-98825251 CCTCCCGCCCCGGGAGGTCAGGC 0: 1
1: 0
2: 2
3: 26
4: 322
Right 1045098703 8:98825243-98825265 AGGTCAGGCCGCAGGGAGCCCGG No data
1045098695_1045098712 29 Left 1045098695 8:98825229-98825251 CCTCCCGCCCCGGGAGGTCAGGC 0: 1
1: 0
2: 2
3: 26
4: 322
Right 1045098712 8:98825281-98825303 TTTCCACGCGCCAGGCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045098695 Original CRISPR GCCTGACCTCCCGGGGCGGG AGG (reversed) Intronic
900246845 1:1640270-1640292 GCCTGACCTGCAGGGCCGGCAGG + Exonic
900258067 1:1707402-1707424 GCCTGACCTGCAGGGCCGGCAGG + Exonic
900298663 1:1965641-1965663 CCCTGGCTTCCCGGGGTGGGGGG + Intronic
900394178 1:2446387-2446409 GCCAGGTCTCCCGGGGCTGGGGG + Intronic
901066033 1:6495099-6495121 GCCTGACCTGAAGGGGCGGCTGG - Intronic
901234769 1:7661871-7661893 GCCGGGGCTCCCGGGGCAGGCGG + Intronic
901341906 1:8502491-8502513 CCCTGACCTCCCGGATGGGGCGG - Intronic
901676471 1:10888740-10888762 GCCCCACCCCCCGGCGCGGGAGG + Intergenic
902955111 1:19920268-19920290 GCGGGACCTCCAGGGACGGGGGG + Exonic
903508250 1:23853467-23853489 CCCTCACCTCCCGGACCGGGCGG - Intronic
903907317 1:26696226-26696248 GCCTGAGCCGGCGGGGCGGGGGG + Exonic
904442220 1:30539315-30539337 CCCTGAACTCCAGGGGCCGGGGG - Intergenic
904489181 1:30847695-30847717 GCGTCATCTCCCGGGGCGGGCGG + Intergenic
905887088 1:41497201-41497223 GCCAGTCCTCCCGTGGCTGGGGG - Intergenic
906524722 1:46487540-46487562 GCCAGACCTGCCCGGGCTGGGGG - Intergenic
907239273 1:53071614-53071636 GCCTGACTTCCCGAGGTGAGGGG + Exonic
912298407 1:108489742-108489764 CCCTCACCTCCCGGACCGGGCGG + Intergenic
912513943 1:110206597-110206619 GCCTGACATCCCTAAGCGGGGGG + Intergenic
914893733 1:151651192-151651214 CCCTCACCTCCCGGGCGGGGCGG + Intronic
915117664 1:153610767-153610789 TCCTGGCCTCCAGGGGAGGGAGG - Intronic
915539829 1:156558526-156558548 CCCTCACCTCCCGGGTGGGGCGG - Intronic
916783013 1:168056461-168056483 GCCCCGCCTCCCGGCGCGGGTGG - Intronic
917206074 1:172572103-172572125 CCCTCACCTCCCGGACCGGGTGG - Intronic
917905836 1:179586624-179586646 GCCTGGCCTCCCGCGGCGGGTGG - Intergenic
919080266 1:192857788-192857810 CCCTCACCTCCCGGACCGGGCGG - Intergenic
920195060 1:204221471-204221493 CGCTGCCCTCCCGGGGCAGGTGG + Exonic
920251418 1:204624756-204624778 CCCTCAGCTCCCGGGGGGGGGGG - Intronic
920257316 1:204664396-204664418 GCCTGACCTCCTGAGGCCGACGG + Intronic
922503807 1:226115066-226115088 CCCTCACCTCCCGGAGGGGGCGG + Intergenic
922891043 1:229062210-229062232 GCCTGACTCCCAGGGGCAGGGGG + Intergenic
923107165 1:230863652-230863674 GCCTGAGCTCCCAGGGCAGCAGG + Intronic
924305936 1:242689535-242689557 CCCTGACTGCCCGGGGCTGGCGG - Intergenic
1062932870 10:1364016-1364038 GCCTGACCTGGGGGCGCGGGCGG - Intronic
1066464290 10:35639737-35639759 GCGTGGCCTCCCAGCGCGGGCGG + Exonic
1067026589 10:42847739-42847761 CCCTCACCTCCCGGGCGGGGCGG - Intergenic
1068690112 10:59906062-59906084 GCAGCCCCTCCCGGGGCGGGCGG + Intronic
1068953944 10:62805112-62805134 GCCTCACCTTCCGGGGCAGCGGG + Exonic
1069554743 10:69390320-69390342 GCCTGACCTCCCAGGAGGGAAGG - Intronic
1070683992 10:78468519-78468541 CCCTCACCTCCCGGGCAGGGCGG + Intergenic
1071573709 10:86711468-86711490 GCCGGGCCTCCCGGAGAGGGAGG - Intronic
1071731409 10:88252464-88252486 GCCAGACCTCACGAGGTGGGTGG + Intergenic
1072180617 10:92976077-92976099 CCCTCACCTCCCGGGCGGGGCGG - Intronic
1072980271 10:100093215-100093237 CCCTCACCTCCCGGACCGGGCGG - Intergenic
1076629047 10:131841815-131841837 GTCTGTCCTCCCAGGGAGGGAGG - Intergenic
1076710552 10:132331693-132331715 GCCGGAGGGCCCGGGGCGGGCGG - Intronic
1077061118 11:618295-618317 GCTTGGCCTCCCGGGGGGGAGGG - Intronic
1077501055 11:2909872-2909894 GCCTGACCTCCCGGGCTGGCTGG + Intronic
1079371792 11:19859731-19859753 CCCTCACCTCCCGGACCGGGCGG + Intronic
1082076618 11:47980469-47980491 GCCGGGCCGGCCGGGGCGGGAGG + Intergenic
1082844465 11:57716173-57716195 CCCTCACCTCCCGGACCGGGCGG + Intronic
1083115123 11:60451801-60451823 CCCTCACCTCCCGGGTGGGGCGG - Intronic
1083460052 11:62805242-62805264 GCCTCAGCCCCCGGGGCGTGAGG - Intronic
1083618460 11:64037407-64037429 GCCTCTCCTCCCGGGGCTGGCGG - Intronic
1083901739 11:65646701-65646723 GCCTGCCCTCCCTGGGTGGGAGG + Exonic
1084597316 11:70124671-70124693 GCCTGGCCTCACTGGGCGGCGGG + Intronic
1086430601 11:86732550-86732572 CCCTCACCTCCCGGGTGGGGCGG - Intergenic
1088279372 11:108121303-108121325 GTCTAACCTGCCGGGGCCGGTGG - Intergenic
1089244746 11:117110705-117110727 CCCTCACTGCCCGGGGCGGGAGG + Intergenic
1090193193 11:124791452-124791474 GCCTGACCTCCCAGTGCAGGTGG - Intronic
1090197473 11:124828975-124828997 GCCTGACCTCCAGGGAGGGAAGG + Intergenic
1090699084 11:129278951-129278973 CCCCGGCCTCCCGGGGCGGACGG - Intronic
1091207661 11:133832763-133832785 GCAGGACTTCGCGGGGCGGGCGG - Intergenic
1091728021 12:2858958-2858980 GCCTGACCCCCTGGGGCTGATGG - Exonic
1093465089 12:19440289-19440311 GCGCGACCTCCGGGGGCCGGCGG + Exonic
1096024669 12:48350718-48350740 GCCTGGCTTCCCGGGGCGGCTGG - Exonic
1096064028 12:48724969-48724991 CCCTCACCTCCCGGGTGGGGCGG - Intergenic
1096257740 12:50073361-50073383 GCCTGCCCTGCCAGGGAGGGCGG - Intronic
1096536671 12:52279346-52279368 GCCTCACGTCCCGGTGTGGGAGG - Intronic
1097223062 12:57461674-57461696 TACTGGGCTCCCGGGGCGGGTGG + Intronic
1100048260 12:90411300-90411322 CCCCTACCTCCCGGGGCGGCTGG - Intergenic
1102349764 12:112183943-112183965 GCCTGGCCTTCCGCGGTGGGTGG - Intronic
1102493760 12:113305208-113305230 GCCTGACCTCCCAGGTTGGCTGG - Intronic
1104768586 12:131346176-131346198 GCCACACTTCCCAGGGCGGGAGG - Intergenic
1105248540 13:18674110-18674132 CCCTCACCTCCCGGGCGGGGCGG - Intergenic
1105349442 13:19602245-19602267 GCGTGACCTTCCCGGGCGGCGGG + Intergenic
1105526933 13:21186307-21186329 CCCTCACCTCCCGGGCGGGGCGG + Intergenic
1106495437 13:30270325-30270347 CCCTCACCTCCCGGGTGGGGCGG - Intronic
1112325372 13:98439998-98440020 GCCTGACCCTCCGGGGCCAGCGG + Exonic
1112339953 13:98544564-98544586 GCATTGCCTCCTGGGGCGGGCGG - Intronic
1115688841 14:35824545-35824567 CCCTCACCTCCCGGGCGGGGCGG + Intergenic
1117277440 14:54204306-54204328 CCCTCACCTCCCGGGCAGGGCGG - Intergenic
1117392058 14:55271633-55271655 GCCTGCGCTCCCGGGGCGCGGGG + Intronic
1118896354 14:69949084-69949106 GCCTGACCTCCCTGGAGGGCAGG - Intronic
1119254174 14:73183888-73183910 CCCTCACCTCCCGGGCGGGGCGG + Intronic
1119330175 14:73787413-73787435 GGCTTCCCTCCCAGGGCGGGGGG - Intronic
1119786917 14:77320906-77320928 GCCGGCCGGCCCGGGGCGGGGGG + Exonic
1120309760 14:82814210-82814232 CCCTCACCTCCCGGAGGGGGCGG + Intergenic
1120799096 14:88669336-88669358 GACTGAGCTCCCTGGGCGAGGGG + Intronic
1121259447 14:92555540-92555562 GCCTCACATCCTGGGTCGGGTGG + Intronic
1121639494 14:95475692-95475714 GCCTGGCCTCCAGGGCCGCGCGG + Exonic
1122779696 14:104138496-104138518 GCTCGGGCTCCCGGGGCGGGCGG - Intergenic
1122780768 14:104142521-104142543 CCCTGGCCTCCCTGGGCTGGAGG + Intronic
1122977553 14:105177130-105177152 GCCTGACCTCCCTGGGCTGCTGG - Intronic
1123056322 14:105572285-105572307 GCCTGAGCTGCCGGGTCGGGGGG + Intergenic
1123057609 14:105579522-105579544 GCCTGAGCTGCCGGGTCGGGGGG - Intergenic
1123062920 14:105602256-105602278 CCCTGACCTCTAGGGGAGGGCGG + Intergenic
1123080753 14:105692413-105692435 GCCTGAGCTGCCGGGTCGGGGGG + Intergenic
1123081888 14:105699455-105699477 GCCTGAGCTGCCGGGTCGGGGGG - Intergenic
1123985727 15:25644308-25644330 GCCTGACCACACTGGGCAGGAGG + Intergenic
1124628923 15:31326457-31326479 GCATGACGTCCGGGGGCGGCGGG - Intergenic
1125566847 15:40683524-40683546 CCCTGACCTCCCGGACGGGGCGG - Intergenic
1126649789 15:50908936-50908958 CCCTGAGCTCCCGGGCCGGCGGG - Intronic
1128356835 15:66934047-66934069 GCCTGACCTCTGGGGAGGGGAGG - Intergenic
1129724397 15:77894226-77894248 CCCTCACTGCCCGGGGCGGGCGG + Intergenic
1129933648 15:79432015-79432037 GCTTGAGCGCCCCGGGCGGGCGG + Intergenic
1132439213 15:101841959-101841981 GCCTCACCACCCAGGGCTGGAGG - Intergenic
1132585691 16:705076-705098 GGCGGCCCTCCCCGGGCGGGCGG - Intronic
1132666377 16:1083029-1083051 TCCTCACCTCCCGGGGCAGTGGG + Intergenic
1132677541 16:1126886-1126908 GCCTGAGCTCCCTGTGCAGGGGG + Intergenic
1132715821 16:1289360-1289382 ACCTGACCTGCAGGGGCGGGGGG + Intergenic
1133784178 16:8962798-8962820 TCCTGACCTCCCCGGGCGCGGGG - Intronic
1134471803 16:14532720-14532742 CCCTCACCTCCCGGGAGGGGCGG + Intronic
1135470214 16:22723195-22723217 CCCTTACCACCCGGGGCCGGTGG + Intergenic
1136160719 16:28417043-28417065 CCCTCACCTCCCGGGCGGGGCGG - Intergenic
1136202249 16:28697958-28697980 CCCTCACCTCCCGGGCGGGGCGG + Intronic
1136643541 16:31588920-31588942 GACTGAGCTCCCGGGGGGAGGGG - Intergenic
1136662073 16:31771889-31771911 GACTGAGCTCCCGGGGGGAGGGG + Intronic
1139623107 16:68163328-68163350 CCCTCACCTCCCGGGCGGGGCGG + Intronic
1141086055 16:81096317-81096339 GCCCCGCCTCCCGGCGCGGGTGG - Exonic
1142332436 16:89463077-89463099 CCCTCACCTCCCGGGCGGGGCGG - Intronic
1142533773 17:599155-599177 CCCTCACCTCCCGGGCGGGGCGG - Intronic
1142939556 17:3371207-3371229 CCCTCACCTCCCGGGTGGGGCGG + Intergenic
1142979343 17:3662734-3662756 GCCTGAAAGCCCGGGGCTGGTGG - Intergenic
1143092529 17:4457577-4457599 GCCTGACCTCACAGGGAGGCTGG + Intronic
1143689696 17:8550544-8550566 CCCTCACCTCCCGGGCAGGGCGG - Intronic
1145960899 17:28886042-28886064 GCCTGACGCCTGGGGGCGGGGGG + Intronic
1145997434 17:29112721-29112743 GCCTGGCCTTCAGGGGCTGGAGG + Intronic
1147572345 17:41579156-41579178 GCCTGATCCCCAGGGGCTGGGGG - Intergenic
1147805332 17:43126928-43126950 CCCTGACTGCCCGGGGCCGGGGG - Intergenic
1147921209 17:43918111-43918133 CCCTGACCTCCGGGGTAGGGTGG + Intergenic
1148122527 17:45221598-45221620 GCTTCACCTGCCGGAGCGGGAGG - Intronic
1148280146 17:46341208-46341230 CCCTGACCTCCGGGGTAGGGTGG - Intronic
1148302374 17:46559145-46559167 CCCTGACCTCCGGGGTAGGGTGG - Intronic
1148404458 17:47398265-47398287 CCCTCACCTCCCGGGCGGGGTGG - Intronic
1148406595 17:47421048-47421070 CCCTCACCTCCCGGGCGGGGTGG - Intronic
1149625048 17:58074301-58074323 CCCTCACCTCCCGGAGGGGGCGG + Intergenic
1150399859 17:64848183-64848205 CCCTGACCTCCGGGGTAGGGTGG + Intergenic
1150477269 17:65484639-65484661 CCCTCACCTCCCGGACCGGGCGG - Intergenic
1151798923 17:76365969-76365991 GCCTGACTTCCGGGGACGGAGGG + Intronic
1152277681 17:79367686-79367708 GCCTGTCCTCCCCGGAGGGGTGG - Intronic
1152528656 17:80904073-80904095 GCAGCACCTCCCGGGCCGGGTGG - Intronic
1152532095 17:80924655-80924677 ACCCGACCCCCCGGGGTGGGGGG + Intronic
1152622590 17:81372723-81372745 GCCTGTACTCCTGGGGTGGGGGG - Intergenic
1152661443 17:81544162-81544184 GCCTGAGCCCCCCGGGCAGGTGG - Intronic
1152728745 17:81959968-81959990 GGCGGTCCTCCCGGGGCGCGCGG + Intronic
1152859730 17:82689202-82689224 GCCTGCACTCCTGGGGCAGGAGG + Intronic
1154005763 18:10526219-10526241 GCCTTAGCACCCGGGGGGGGCGG + Intronic
1154218371 18:12431874-12431896 GCCTCACCTGCTGGGGCTGGAGG + Exonic
1154265432 18:12874710-12874732 CCCTCACCTCCCGGGTGGGGCGG - Intronic
1155956759 18:31961040-31961062 CCCTCACCTCCCGGGTGGGGCGG - Intergenic
1156350603 18:36298185-36298207 GCAGGACCCTCCGGGGCGGGCGG + Intronic
1157849151 18:51030773-51030795 GCCTGACGAGCCGGGCCGGGCGG + Intronic
1158276022 18:55768362-55768384 GCCTGACCTCCAGGGAAGGGAGG - Intergenic
1159340402 18:67126777-67126799 CCCTCACCTCCCGGGCGGGGCGG + Intergenic
1159351917 18:67286457-67286479 GCCTGACCTCCAGGAGCCAGAGG - Intergenic
1160242508 18:77133267-77133289 GCCTGGGCTCCAGGGGAGGGAGG - Intronic
1161059455 19:2207799-2207821 GCCTGAGCTCAGGGGCCGGGGGG - Intronic
1161246655 19:3256291-3256313 CCCTGACCTCTCAGGGCTGGGGG + Intronic
1161248997 19:3270593-3270615 GCCTGTGCGCCCGGGGCGGCCGG + Intronic
1161284936 19:3464029-3464051 TCCTGCCCTGCCGGGGCGCGGGG + Intronic
1161475631 19:4483341-4483363 GCCTCTCCTCCCGGCGCGGGAGG + Intronic
1161653642 19:5499698-5499720 TCCTGACCTGCCGAGGCTGGAGG - Intergenic
1161919429 19:7255036-7255058 GCCTGGCTTCCTGGAGCGGGTGG - Intronic
1161998972 19:7731225-7731247 GCCTGGGCCCCCGGGGCGTGAGG - Intronic
1164601276 19:29565252-29565274 TCCTGGCCTCCTGTGGCGGGTGG + Intergenic
1164698576 19:30265372-30265394 TCCTGACCTGCAGGAGCGGGAGG - Intronic
1165091671 19:33391222-33391244 GCCTGACCCCCAGGGCAGGGTGG - Intronic
1165101448 19:33440938-33440960 GCCTGACTTCCCAGGATGGGTGG + Intronic
1165742257 19:38211261-38211283 GCCAGGCCTGGCGGGGCGGGAGG + Intronic
1165842514 19:38797718-38797740 CCCTCACCTCCCGGACCGGGCGG + Intergenic
1166100337 19:40567911-40567933 GCCGGAGATCCCGGGGAGGGTGG + Exonic
1166114915 19:40648085-40648107 CCCTGACCTCCCGGACGGGGCGG + Intergenic
1166301279 19:41913331-41913353 GCCTGACCTCCCGGGTCGGTCGG + Intronic
1166367275 19:42284130-42284152 GTCTGCCCGCCCGGGGCCGGAGG + Intronic
1167313831 19:48752699-48752721 GTCCGCCCTCCCGGGCCGGGCGG + Exonic
1168475770 19:56673848-56673870 GCCTGGCCTCCTGGGGTTGGAGG + Intergenic
926609048 2:14927052-14927074 GACTGACCTCCCTGAGCGAGAGG + Intergenic
927652518 2:24920696-24920718 GTCTGGGCTCCCGGGGTGGGCGG - Intergenic
927787332 2:25982672-25982694 GCCTGTCATCCCGGAGCGGTCGG - Intronic
928002902 2:27539829-27539851 CCCTCACCTCCCGGACCGGGCGG + Intronic
928596995 2:32868822-32868844 CCCTCACCTCCCGGACCGGGCGG - Intergenic
929061893 2:37932653-37932675 CCCTCACCTCACGGGGCGGCTGG + Intronic
929416095 2:41747112-41747134 CCCTCACCTCCCGGACCGGGCGG - Intergenic
929458913 2:42086776-42086798 GCCTGACTTCCCGAGGCAGTGGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
929665632 2:43831894-43831916 GCCTAAGCCCCCGGGGCGGGCGG + Intronic
929857928 2:45651556-45651578 CTCTGACCGCGCGGGGCGGGGGG - Intronic
930752730 2:54948521-54948543 GCCTGACCATGAGGGGCGGGAGG - Intronic
931584276 2:63809189-63809211 CCCTCACCTCCCGGGCGGGGCGG - Intronic
932367318 2:71161359-71161381 CCCTCACCTCCCGGAGGGGGCGG - Intergenic
934521995 2:95025595-95025617 GCCGGGTCTCCCGGGGCGTGGGG + Intergenic
934772191 2:96914129-96914151 GTATGAGCTCCCTGGGCGGGAGG - Intronic
936261279 2:110961456-110961478 GCCTGACTTCCAGGGCAGGGTGG + Intronic
937126517 2:119478343-119478365 CCCTGGCCTCCTGGGGCGAGGGG - Intronic
937135062 2:119544827-119544849 GCCAGGCCTACCGGGGCGGTGGG + Intronic
937826061 2:126369725-126369747 GCCTGATCTCCAGGGGTGGGAGG - Intergenic
938185737 2:129230326-129230348 GCCTGACCTCCCAGGAGAGGAGG - Intergenic
938389655 2:130894765-130894787 GCCTCTCCTCCTGTGGCGGGAGG + Intronic
939578378 2:143921899-143921921 CCCTCACCTCCCGGGTGGGGCGG + Intergenic
941159375 2:162018702-162018724 GTCTGAGCTCCCTGGGAGGGAGG - Intronic
944533025 2:200683897-200683919 CCCTCACCTCCCGGGGCGGCTGG + Intergenic
944797993 2:203207315-203207337 CCCTCACCTCCCGGAGGGGGCGG - Intronic
945980536 2:216307087-216307109 GACTCACCTACCAGGGCGGGAGG - Intronic
947592878 2:231395438-231395460 GCGGAGCCTCCCGGGGCGGGGGG - Intergenic
947992307 2:234497161-234497183 GCCTGACCCCCGGCGGCGGGCGG - Intergenic
949042602 2:241856201-241856223 GCCTGTCCTCCCGCCGTGGGGGG - Intronic
1169718337 20:8644731-8644753 CCCTCACCTCCCGGGCGGGGCGG - Intronic
1170596099 20:17806951-17806973 GCCTGCCCCCCCGGGGCGGCTGG - Intergenic
1170622958 20:18010307-18010329 CCCTCACCTCCCGGACCGGGCGG + Intronic
1172141278 20:32724169-32724191 CCCTCACCTCCCGGACCGGGCGG - Intronic
1172293312 20:33791253-33791275 GCCTGACCCGCTGGGGCTGGAGG + Exonic
1172804065 20:37598545-37598567 GCCTGAACTCCTGGGGAGGGAGG + Intergenic
1173743557 20:45419409-45419431 GCCTGGCAGCCGGGGGCGGGGGG + Intronic
1174055619 20:47796225-47796247 GCCTGTCCTCCCGGGGAGGCTGG - Intergenic
1174344904 20:49922346-49922368 CCCTCACCTCCCGGACCGGGCGG - Intergenic
1175191041 20:57212363-57212385 ACCTGACCTCCCGCGGCCAGAGG - Intronic
1175743468 20:61436727-61436749 GCCTGACCTCCAGATGGGGGTGG - Intronic
1175821017 20:61908858-61908880 GCCTGACCTTCCAGGGCTGCAGG - Intronic
1176041319 20:63067409-63067431 GCCTGACCACTCGAGGCAGGAGG - Intergenic
1177013977 21:15761318-15761340 GCCTGACATTCCTGGGGGGGAGG - Intronic
1178498889 21:33109807-33109829 GCCAGATGTCCCGGAGCGGGAGG - Intergenic
1179081146 21:38171898-38171920 TGCTGACCTCCAGGGGCTGGTGG - Intronic
1180077051 21:45468285-45468307 GGGTGACCTGCTGGGGCGGGGGG - Exonic
1180834652 22:18923798-18923820 GCCTGTTCTCCCAGGGCAGGTGG - Intronic
1181046824 22:20218596-20218618 GGCAGAGCTCCCGGGGAGGGAGG - Intergenic
1181531808 22:23521512-23521534 GCCTGACCTCCCCTGGGGGTGGG - Intergenic
1182406635 22:30139021-30139043 GACTGGCCTCCCTGAGCGGGAGG + Intronic
1182527045 22:30926985-30927007 GCCTGACATCCAGGGCGGGGTGG - Intronic
1182809700 22:33105435-33105457 GCCTGGCCAGCCTGGGCGGGTGG - Intergenic
1183232677 22:36592848-36592870 CCCTGACCTCCTGGGGCTGCTGG - Intronic
1183367361 22:37414050-37414072 GACTGACCTCCCAGGGTGGCTGG + Intronic
1184735972 22:46398063-46398085 GCCTGAGCTCCTGGGGTGCGCGG + Intronic
1185082726 22:48718674-48718696 GGTTGACCTCACGGGGCCGGGGG - Intronic
1185384047 22:50523522-50523544 GCCTGGCCTCCCTGGGCCGCTGG + Intergenic
1203284741 22_KI270734v1_random:149097-149119 GCCTGTTCTCCCAGGGCAGGTGG - Intergenic
949355035 3:3171392-3171414 GAATGATCTCCTGGGGCGGGTGG - Intronic
950132978 3:10560312-10560334 GCCTGTCCTCCCAGGACGGATGG + Intronic
950412668 3:12849618-12849640 CCCTCACCTCCCGGGCGGGGCGG + Intronic
950819620 3:15742779-15742801 CCCTCACCTCCCGGACCGGGTGG - Intronic
953426107 3:42797983-42798005 CCCTCACCTCCCGGACCGGGCGG - Intronic
953426414 3:42798691-42798713 CCCTCACCTCCCGGGCGGGGCGG - Intronic
954226203 3:49182875-49182897 CCCTCACTGCCCGGGGCGGGGGG + Intronic
954356046 3:50084546-50084568 CCCTCACCTCCCGGACCGGGCGG + Intronic
954697583 3:52435856-52435878 GCCAGGCCTCCCCGGGCTGGGGG + Exonic
955674322 3:61434384-61434406 CCCTCACCTCCCGGGCGGGGCGG + Intergenic
956311703 3:67888119-67888141 GCCTGACTTCCTGGGTCGAGTGG + Intergenic
956697230 3:71928949-71928971 CCCTCACCTCCCGGACCGGGCGG - Intergenic
959062216 3:101626001-101626023 CCCTGACCTCCTGGGGAGGTAGG - Intergenic
959201632 3:103254915-103254937 CCCTCACCTCCCGGGTGGGGCGG + Intergenic
961729309 3:128954640-128954662 CCCTCACCTCCCGGACCGGGCGG - Intronic
961784092 3:129339050-129339072 CCCTCACCTCCCGGGCGGGGCGG + Intergenic
963116952 3:141738382-141738404 GCCTGAGCTCCCGGAGTGAGAGG - Exonic
963509476 3:146229324-146229346 GCCTGACCTCCAGGGGGGTGGGG + Intronic
966943472 3:184761363-184761385 GCTTGACATCCCTGGGCTGGAGG + Intergenic
967136704 3:186518575-186518597 GCCTGGCCTTCCAGGACGGGAGG + Intergenic
967272617 3:187743742-187743764 GGCTGAGCTCCGGGGGCGGGCGG - Intronic
967858784 3:194136782-194136804 GCCAGACCCCGCAGGGCGGGGGG - Intronic
968552118 4:1229155-1229177 CCCTGCCCTCCCTGGGCTGGGGG - Intronic
968613377 4:1566977-1566999 GCCTGACCTGACGGGGGTGGGGG - Intergenic
968645503 4:1738492-1738514 GCCTGGGCTCCGGGGGCAGGTGG + Intronic
968650983 4:1760202-1760224 CCCTGAGCTCCCGGAGCTGGAGG - Intergenic
968913118 4:3485706-3485728 GTGCGACGTCCCGGGGCGGGGGG + Intronic
969303167 4:6309277-6309299 CCCTCACCGCCCGTGGCGGGCGG + Intergenic
969721853 4:8896410-8896432 GCCTGACCTCAGGAGGCTGGTGG + Intergenic
970386453 4:15561726-15561748 GACTTACCTCCAGGGGAGGGAGG + Intronic
972412521 4:38807907-38807929 CCCTCACCTCCCGGACCGGGTGG - Intronic
972412595 4:38808083-38808105 CCCTCACCTCCCGGACCGGGCGG - Intronic
972551725 4:40141180-40141202 CCCTCACCTCCCGGAGGGGGCGG + Intronic
976002147 4:80386419-80386441 GCCTGACCCGCTGGGGCTGGAGG - Intronic
977205182 4:94158250-94158272 CCCTCACCTCCCGGGCGGGGCGG - Intergenic
979641392 4:123015775-123015797 CCCTCACCTCCCGGACCGGGCGG + Intronic
982026034 4:151254911-151254933 CCCTCACCTCCCGGGAGGGGCGG + Intronic
983218002 4:165019800-165019822 CCCTCACCTCCCGGGCGGGGCGG + Intergenic
985269289 4:188179070-188179092 CCCTCACTGCCCGGGGCGGGCGG - Intergenic
985544344 5:501658-501680 GCTGGACCTGCAGGGGCGGGTGG - Intronic
986140612 5:5026352-5026374 GACTGATCTCCCGGGGGGAGGGG + Intergenic
987513956 5:18881416-18881438 CCCTGACCTCCCTGGCAGGGAGG + Intergenic
988760573 5:34306670-34306692 CCCTCACCTCCCGGACCGGGCGG + Intergenic
988780949 5:34521481-34521503 ACCTGGGCTCTCGGGGCGGGAGG - Intergenic
989634894 5:43522355-43522377 CCCTCACCTCCCGGGCGGGGCGG - Intergenic
992097379 5:73375619-73375641 GCATGCCCTCCCGGGTCGAGAGG + Intergenic
992391609 5:76336012-76336034 CCCTCACCTCCCGGAGGGGGCGG + Intronic
992463486 5:76984434-76984456 CCCTCACCTCCCGGACCGGGCGG + Intergenic
994529012 5:100942744-100942766 GCCTGTAATCCCGAGGCGGGTGG - Intergenic
995123560 5:108559219-108559241 CCCTCACCTCCCGGAGGGGGCGG + Intergenic
996815570 5:127569564-127569586 CCCTCACCGCCCGGGGCCGGCGG - Intergenic
997565247 5:134881905-134881927 CCCTGACCTCCCGGACGGGGCGG + Intronic
998053763 5:139056721-139056743 CCCTCACCTCCCGGGCGGGGCGG - Intronic
998467402 5:142356928-142356950 GCGTCACCTCCGGGGGCGCGCGG - Intergenic
1000159239 5:158582788-158582810 GCCTCACCTCCCGGACGGGGCGG - Intergenic
1001439140 5:171725250-171725272 GCCTGACCTCCGGGTGGGTGGGG + Intergenic
1001597852 5:172909464-172909486 GCCTTACCTCTCAGGACGGGAGG - Intronic
1002115861 5:176961666-176961688 CCCTCACCTCCCGGACCGGGCGG - Intronic
1002467717 5:179416121-179416143 GGCTGCCCTCCTGGGGCTGGAGG - Intergenic
1002612773 5:180432275-180432297 CCCTCACCACCCGGGGCTGGTGG - Intergenic
1002764467 6:227206-227228 GCCTGACCTCTAGGGAAGGGAGG - Intergenic
1007633488 6:43285220-43285242 GCGGGACGCCCCGGGGCGGGGGG - Exonic
1008773680 6:55009293-55009315 CGCTGAGCTCCCTGGGCGGGGGG - Intergenic
1010513338 6:76744901-76744923 CCCTCACCTCCCGGGTGGGGCGG - Intergenic
1013190921 6:107803453-107803475 CCCTCACCTCCCGGACCGGGCGG - Intronic
1013206935 6:107953870-107953892 CCCTCACCTCCCGGACCGGGCGG - Intronic
1013681239 6:112528252-112528274 CCCTCACCTCCCGGACCGGGCGG + Intergenic
1018926322 6:168209431-168209453 GCCTGGCCTCCTGGGGATGGTGG + Intergenic
1019017298 6:168889135-168889157 CGCTGACCTCCAGGGGCTGGTGG + Intergenic
1019554597 7:1622625-1622647 GCCTCACTTCCTGGGGCGGGGGG - Intergenic
1022474325 7:30700107-30700129 GCCTCCCCTCCAGGGCCGGGTGG - Intronic
1023896156 7:44434558-44434580 GCCTGATATTGCGGGGCGGGGGG - Intronic
1024989100 7:55220150-55220172 CCCTCACCTCCCGGACCGGGCGG + Intronic
1025237366 7:57243907-57243929 GCCTGTCCTCCTGGGGAGGCTGG + Intergenic
1028227412 7:88266521-88266543 CCCTCACCTCCCGGAGGGGGCGG + Intergenic
1029468867 7:100741827-100741849 CCCTCACCTCCCGGACCGGGCGG + Intronic
1030036165 7:105410596-105410618 CCCTCACCTCCCGGGCGGGGCGG + Intergenic
1030215727 7:107042569-107042591 CCCTGACTGCCCGGGGCCGGTGG + Intergenic
1032042709 7:128576601-128576623 CCCTCACCTCCCGGACCGGGCGG + Intergenic
1033223956 7:139546228-139546250 CCCTGAACTCCCAGGGCAGGAGG - Intergenic
1034429266 7:151033077-151033099 TCCTCACCTCCCTGGGAGGGAGG - Intronic
1036398298 8:8386678-8386700 GCCTGCCGGTCCGGGGCGGGAGG - Intergenic
1037988213 8:23302833-23302855 GCCACACCTGCCGGGACGGGGGG + Intronic
1038418077 8:27412223-27412245 GCCTGACCTCCAGGGAGGGAAGG - Intronic
1039875185 8:41578592-41578614 CCCCGGACTCCCGGGGCGGGAGG - Intronic
1040928818 8:52713899-52713921 GCAACACCTGCCGGGGCGGGAGG + Intronic
1041270262 8:56104238-56104260 CCCTCACCTCCCGGAGGGGGCGG + Intergenic
1042367299 8:67952195-67952217 GGCTGAAATCCCGGCGCGGGGGG - Exonic
1042747856 8:72127014-72127036 GCCTGACATTCCTGGGTGGGTGG - Intergenic
1043390132 8:79784111-79784133 GCGGGCCCTCCCTGGGCGGGCGG + Intergenic
1045098695 8:98825229-98825251 GCCTGACCTCCCGGGGCGGGAGG - Intronic
1045524267 8:102928736-102928758 CCCTCACCTCCCGGGCGGGGCGG - Intronic
1047781912 8:128118406-128118428 CCCTCACCTCCCGGAGGGGGCGG + Intergenic
1049696998 8:143989152-143989174 GCCGGCCCTCCAAGGGCGGGAGG + Intronic
1049704937 8:144037221-144037243 CCCTCACCTCCCGGGCGGGGCGG - Intronic
1055133797 9:72806135-72806157 CCCTCACCTCCCGGGCGGGGCGG + Intronic
1055136939 9:72840182-72840204 CCCTCACCTCCCGGACCGGGCGG + Intergenic
1056706848 9:88959292-88959314 CCCTCACCTCCCGGGTGGGGCGG + Intergenic
1057042423 9:91857312-91857334 GCTTGACCTCACTGGGCAGGCGG + Intronic
1058309498 9:103483821-103483843 CCCTCACTTCCCGGGGCTGGTGG - Intergenic
1058722616 9:107776391-107776413 CCCTCACCTCCCGGACCGGGCGG - Intergenic
1060042140 9:120308843-120308865 GCCTGACTTCCTGGGGGTGGGGG + Intergenic
1061303984 9:129722228-129722250 GCCTGAGCTCCCAGGGCTGTAGG - Exonic
1061856665 9:133445330-133445352 GCCTGGCGTCCAGGGGCTGGAGG + Intronic
1061986951 9:134135581-134135603 TCCTGCCCGCCCGGGGTGGGAGG + Intronic
1062274844 9:135725886-135725908 ACCTGGGCTCCCAGGGCGGGTGG - Intronic
1062583842 9:137240305-137240327 CCCAGACCTCCCTCGGCGGGTGG - Intergenic
1186741042 X:12518088-12518110 GACTGACCTCCCAGGGGGAGGGG - Intronic
1192464001 X:71341570-71341592 CCCTCACCTCCCGGACCGGGCGG + Intergenic
1192663994 X:73069290-73069312 CCCTCACCTCCCGGGTGGGGTGG - Intergenic
1193132327 X:77931909-77931931 CCCTCACCTCCCGGACCGGGCGG + Intronic
1193365196 X:80623366-80623388 GTCTGAGCTCCCTGGGCAGGGGG - Intergenic
1196283871 X:113856982-113857004 GCCTGAGAACCTGGGGCGGGGGG - Intergenic
1199586547 X:149421173-149421195 CCCTCACCTCCCGGGCGGGGTGG - Intergenic
1200115554 X:153768305-153768327 GCTGGACCTCCAGGGGCTGGCGG - Exonic
1200147639 X:153934863-153934885 GGGTGAGCGCCCGGGGCGGGAGG - Exonic