ID: 1045098946

View in Genome Browser
Species Human (GRCh38)
Location 8:98825892-98825914
Sequence CTTCTCTGGGCCGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045098946_1045098964 27 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098964 8:98825942-98825964 GGGCGGAGCCTGCCGCGGCCTGG No data
1045098946_1045098953 -8 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098953 8:98825907-98825929 CAGAGAAGGTGGACGGAGCCGGG No data
1045098946_1045098955 3 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098955 8:98825918-98825940 GACGGAGCCGGGCACCGCGGCGG No data
1045098946_1045098957 5 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098957 8:98825920-98825942 CGGAGCCGGGCACCGCGGCGGGG No data
1045098946_1045098954 0 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098954 8:98825915-98825937 GTGGACGGAGCCGGGCACCGCGG No data
1045098946_1045098952 -9 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098952 8:98825906-98825928 CCAGAGAAGGTGGACGGAGCCGG No data
1045098946_1045098961 10 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098961 8:98825925-98825947 CCGGGCACCGCGGCGGGGGGCGG No data
1045098946_1045098965 28 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098965 8:98825943-98825965 GGCGGAGCCTGCCGCGGCCTGGG No data
1045098946_1045098963 22 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098963 8:98825937-98825959 GCGGGGGGCGGAGCCTGCCGCGG No data
1045098946_1045098958 6 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098958 8:98825921-98825943 GGAGCCGGGCACCGCGGCGGGGG No data
1045098946_1045098956 4 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098956 8:98825919-98825941 ACGGAGCCGGGCACCGCGGCGGG No data
1045098946_1045098959 7 Left 1045098946 8:98825892-98825914 CCTGCGGCGGCGGCCCAGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1045098959 8:98825922-98825944 GAGCCGGGCACCGCGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045098946 Original CRISPR CTTCTCTGGGCCGCCGCCGC AGG (reversed) Intronic
900592845 1:3467623-3467645 CTTCCCAGGGCCCCCGCCCCAGG + Intronic
900786893 1:4655130-4655152 CTTCGCTGTGCCGCCGGCGGAGG + Exonic
902896583 1:19484459-19484481 CTTCTCGAGGCTGCCGCCGTGGG - Intronic
908596835 1:65697207-65697229 CTTCTCTGGGTTGCCTCCGCAGG - Intergenic
915242965 1:154537020-154537042 CTTGTCTGGGGGGCCGCCCCAGG - Intronic
915325433 1:155079326-155079348 CTTCTCTCCGCACCCGCCGCTGG + Intronic
916171913 1:162007770-162007792 CTTCTCTGGGCAGCCCCTGTAGG - Intronic
921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG + Intronic
921177862 1:212609223-212609245 CTTCTCTCCGCCGACGGCGCTGG + Intronic
923147836 1:231210239-231210261 CTTCGCTGGGCCCCAGCCCCAGG + Intronic
1069581900 10:69572301-69572323 CTTTTGAGGGCCGCCGCCGTCGG + Exonic
1073297641 10:102450768-102450790 CAGCTCTCGGCCACCGCCGCGGG + Exonic
1074788154 10:116859890-116859912 CTTCTCTGGGCCTCAGCATCTGG - Intronic
1074977758 10:118595181-118595203 ATTTTCTGGGCTGCCGCCGGCGG - Exonic
1075004260 10:118819043-118819065 CTTCTGTGGGCCACTGCTGCGGG - Intergenic
1076372405 10:129963982-129964004 CTTCGAAGCGCCGCCGCCGCCGG - Intergenic
1076832607 10:133004140-133004162 CTTCTCTGGGCAGAGGCCACTGG + Intergenic
1080457247 11:32428619-32428641 CTTCTCTCCGCCGCTCCCGCAGG - Exonic
1083187499 11:61026235-61026257 CCTCTCTTGGCCGCCGTCCCCGG + Intergenic
1083583347 11:63839215-63839237 CTACTCTCTGCCGCCGCAGCCGG - Exonic
1083796333 11:65018843-65018865 CTTCTCTGGGCCCCCACCATGGG + Intronic
1084717620 11:70883704-70883726 CTTCTCTGTGCCTCCGGCGTGGG - Intronic
1087276644 11:96167453-96167475 GTTCTCTGGGCAGCCTCCTCAGG - Intronic
1087795621 11:102452688-102452710 CTCCTCTGCGCAGCCGGCGCCGG + Exonic
1089537372 11:119168997-119169019 CCCCTCTGGGCCGCGGCCGACGG + Exonic
1091823080 12:3490984-3491006 TTTCTCTGGGCCCCCCGCGCGGG + Intronic
1093972167 12:25385466-25385488 CTTCGCTGGGCCGCAGGCTCTGG - Intergenic
1094017911 12:25884301-25884323 CTGCTCTGGCCCGCTGCTGCGGG + Intergenic
1094839906 12:34338512-34338534 CCTCTTTGGGCGGCCCCCGCTGG - Intergenic
1098943053 12:76559499-76559521 CTTCTCTCGGCCGCTGTCGTCGG + Exonic
1101041424 12:100759787-100759809 GTTCTCTGGGCCTCCCCTGCTGG + Intronic
1101970453 12:109309130-109309152 CCTCGCGGGGCCGCCGCTGCCGG + Exonic
1102254060 12:111406028-111406050 CGCCCCCGGGCCGCCGCCGCCGG - Exonic
1102351264 12:112194006-112194028 CTACTCTGGCCCACCCCCGCAGG + Intronic
1103443273 12:120978914-120978936 CTCCCCTCGACCGCCGCCGCAGG - Exonic
1104854356 12:131895009-131895031 GGTCTCTGTGCCGCCGCGGCCGG - Exonic
1112012169 13:95301496-95301518 CCTCTCAGGCCCGCCGCCTCGGG + Intergenic
1116273284 14:42799739-42799761 CTTTTCTGGCCCACCGCCACTGG - Intergenic
1117315253 14:54566473-54566495 GTTCTCGTGGCCGCCGCCGGCGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121073516 14:91046930-91046952 CTTCTCTGGGAGGCCGAGGCAGG + Intronic
1122418579 14:101561705-101561727 ATTTCCTGGGCCGCCGCCGCCGG + Exonic
1122719914 14:103716131-103716153 CGTCCCCGGGCCGCCGCCTCAGG + Intronic
1202852882 14_GL000225v1_random:31800-31822 CATCTCTGCGCCACCGTCGCTGG + Intergenic
1123875692 15:24621825-24621847 CCTCTCTGGGCCACTGCTGCTGG - Intergenic
1125677589 15:41511220-41511242 CTTGGCTGGGCCGCGGCCGGCGG - Exonic
1128083966 15:64873349-64873371 CTTCTGTGGGCCACCCCCTCTGG - Intronic
1129592753 15:76931881-76931903 CTGCTGTGCGCCGCCGCGGCCGG + Exonic
1130575787 15:85092227-85092249 CTTCACTGGGCCCCTGCAGCTGG - Intronic
1132560096 16:589672-589694 TTTCTCTGGGAGGCAGCCGCAGG + Intronic
1136360923 16:29779291-29779313 CTTCTCTGTGCCTCAGCCTCTGG + Exonic
1136711573 16:32241238-32241260 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136756342 16:32688167-32688189 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1136771820 16:32846916-32846938 CGGCTTTTGGCCGCCGCCGCAGG - Intergenic
1136811770 16:33182207-33182229 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136818246 16:33292287-33292309 CCTGCCTGGGCCGCGGCCGCCGG + Intronic
1136824810 16:33348820-33348842 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136829876 16:33447591-33447613 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1138426048 16:56932540-56932562 CTTCCCTGCCCCGCCGACGCGGG + Intronic
1141615379 16:85206922-85206944 CTCCTCTTGGCCACCGGCGCTGG - Intergenic
1142173454 16:88634515-88634537 CCTGTCTGGGCCTCCGCCTCCGG + Intergenic
1202990348 16_KI270728v1_random:5175-5197 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1203058481 16_KI270728v1_random:948521-948543 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1203074240 16_KI270728v1_random:1109005-1109027 CGGCTTTTGGCCGCCGCCGCAGG - Intergenic
1143163839 17:4887736-4887758 CCTCTATGCGCCGCTGCCGCTGG - Exonic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1148325647 17:46782061-46782083 TTTCCCTGGGCCGCAGCCCCTGG - Intronic
1148556598 17:48582232-48582254 CTCCTCCGCGCCGCCGCCGCCGG - Intronic
1148566025 17:48633562-48633584 CTGGACTGGGCCGCGGCCGCTGG - Intronic
1152719886 17:81918237-81918259 CTTCTTTGGGGCGACGCGGCGGG - Intronic
1155461543 18:26090178-26090200 CTTCCCTGAGCGGCCGCCGCCGG + Intronic
1160499117 18:79393872-79393894 GCGCTCTGGGCCGCCGCCTCCGG + Intergenic
1160527807 18:79547679-79547701 CTGCTCAGGGCCGCCTCCGCTGG - Intergenic
1160957587 19:1700546-1700568 CTCCTCCTGGCCCCCGCCGCCGG + Intergenic
1161703244 19:5805936-5805958 CTGCTCGCCGCCGCCGCCGCCGG + Intergenic
1161963061 19:7533527-7533549 CTCCTCTGCGCCTGCGCCGCCGG - Exonic
1163113857 19:15177928-15177950 CTTCCCGGGGTCGCCGCCGGGGG - Exonic
1163631400 19:18419625-18419647 CTGCTCCACGCCGCCGCCGCCGG - Exonic
1163633652 19:18428962-18428984 CCTCTCTGGGCGCCCCCCGCCGG + Intronic
1165113466 19:33515049-33515071 GTTCTCCGGCCCGCCGCCTCGGG + Intronic
1166546977 19:43639732-43639754 CTGCTGTGGGCGGCCGCGGCGGG - Exonic
1167311246 19:48739130-48739152 CTTCCCACGCCCGCCGCCGCGGG + Exonic
931256925 2:60581933-60581955 TTTGTCTGTGCCGCCGCCGTGGG + Intergenic
931694232 2:64859896-64859918 CCTCTCGGCGCCGCCCCCGCTGG - Intergenic
937438907 2:121900670-121900692 CTTCCCTGGTCCCCCGCCCCTGG - Intergenic
945241581 2:207681533-207681555 CCTCCCTGCGCCGCCGCCTCCGG - Intergenic
947660192 2:231860741-231860763 CGTCACTGGGACGCCGCCTCGGG + Intergenic
948800078 2:240429542-240429564 CCTCCCTGGGCCGCAGCCCCAGG + Intergenic
948824652 2:240568410-240568432 CTCCGCTCGGCCGCCGCCGGGGG - Intronic
1172767250 20:37357346-37357368 CTTCTCTGGGCCACCTTCTCAGG + Intronic
1174143023 20:48430184-48430206 CTCCTCTGGGCTGCCTCCCCTGG + Intergenic
1175413764 20:58788109-58788131 CTTCTCTGGGGAGCCTCCCCTGG - Intergenic
1175721235 20:61288680-61288702 CTTTGCTGGGCTGCCGCGGCCGG + Intronic
1178327929 21:31660152-31660174 GGTCCTTGGGCCGCCGCCGCGGG + Intronic
1178910352 21:36668862-36668884 CCTCCCTGGGCCACCGCAGCTGG - Intergenic
1179608205 21:42531976-42531998 CCTCTCTGGCCCTCCGCCCCTGG - Intronic
1179937769 21:44616022-44616044 CTTCTCTGTGTGGCCTCCGCTGG - Intronic
1183081306 22:35458414-35458436 CTTCTGTGGCCTGCCCCCGCCGG - Intergenic
1183883700 22:40858355-40858377 CCTCTCTGAGCCACCGCCCCAGG + Intronic
1183966155 22:41444213-41444235 CCTGTCTGGGCCGCTGCCTCTGG - Intronic
1184693190 22:46126635-46126657 GTGCCCTGGGCCGCCGCCCCAGG + Intergenic
1184797360 22:46739799-46739821 CGTCTCTGGGCCCCCACCTCTGG - Intergenic
1185055178 22:48575619-48575641 CCACGCTGGGCCGCCGCTGCCGG - Intronic
1185417948 22:50720344-50720366 CTTCTCGCCGCCGCCCCCGCCGG + Intergenic
950168027 3:10816214-10816236 CGGCTCTGCGCCGCCGCCCCGGG - Exonic
950179558 3:10901494-10901516 CTTCCCTGGGCAGCCGGCCCTGG - Intronic
950448890 3:13054665-13054687 CTTCTCTGCGCCTCAGCCTCAGG - Intronic
959539765 3:107524936-107524958 CTTCTCCCGGCCGCGGACGCCGG + Intronic
962770877 3:138609080-138609102 CATCTCTGGGCGGCGGCGGCGGG + Intronic
966886529 3:184380389-184380411 GGGCTCTGGGCCGGCGCCGCGGG - Exonic
968545173 4:1194577-1194599 CTTCTCTGGGCCAGCTGCGCCGG + Intronic
968653861 4:1770418-1770440 CTAATCCGGGCCGCCACCGCGGG + Intergenic
969350544 4:6595844-6595866 CCTCTCTGGGCCCCAGCCTCTGG + Intronic
970374537 4:15443503-15443525 CTTCTCTGGCCCCCAGCCTCAGG - Exonic
976777960 4:88727175-88727197 CTTCTCTGGTCAGCCGTGGCAGG + Exonic
979349324 4:119627492-119627514 CTGCTCTGGGCAGCGGCCGTCGG - Intronic
982291737 4:153788963-153788985 CTTCTCCGCGCCCCAGCCGCCGG - Exonic
996125107 5:119716824-119716846 CTGATCTGGGACGCTGCCGCGGG + Intergenic
1002600587 5:180352408-180352430 CCTGGCTGGGCCGCCTCCGCTGG - Intronic
1003995799 6:11538167-11538189 CTCCTCCAGGCCGCCGCCGCTGG - Intergenic
1006107146 6:31723639-31723661 CTTCTCTGGACGGCCGCCCTGGG + Exonic
1006787576 6:36678829-36678851 CGGCTCTGGGCCGCCGGCCCGGG - Exonic
1014230099 6:118893968-118893990 CCTCTCCGCGCCGCCGCCGGCGG + Intronic
1014554840 6:122833229-122833251 CTTCTCCGGGCAGCAGCCTCAGG + Intergenic
1019667141 7:2257567-2257589 CTTCCCTCGGCCGGCTCCGCAGG - Intronic
1019764998 7:2843763-2843785 CCTCCGTGGTCCGCCGCCGCGGG - Intronic
1025712488 7:63925863-63925885 CTTCTCAGAGCTTCCGCCGCAGG - Intergenic
1029224286 7:99013849-99013871 CCTCTCTGGACCTCTGCCGCAGG + Intergenic
1034488755 7:151381840-151381862 CTTCTCGGGGCCGCCGCCCGTGG - Intronic
1035023065 7:155809976-155809998 CATCTCCGCGCCCCCGCCGCCGG + Intronic
1040531561 8:48270512-48270534 CAGCTCTGGGCAGCCGCTGCTGG + Intergenic
1040794165 8:51271342-51271364 CTTCCCAGGGCCGGCGGCGCAGG - Intergenic
1042399613 8:68330905-68330927 CTCCTCTGGGCGGCAGCAGCAGG - Exonic
1045098946 8:98825892-98825914 CTTCTCTGGGCCGCCGCCGCAGG - Intronic
1047732034 8:127736084-127736106 CTGCTCGCGGCCGCCACCGCCGG + Exonic
1048833325 8:138496866-138496888 CTGCCCTCGCCCGCCGCCGCCGG + Intergenic
1055405968 9:75974082-75974104 CTTCTCTGAGCCTCAGCCCCAGG + Intronic
1057152553 9:92808373-92808395 CGTCCCTGTGCAGCCGCCGCGGG - Intergenic
1061873869 9:133534510-133534532 CGCTCCTGGGCCGCCGCCGCCGG + Intronic
1187094774 X:16136153-16136175 CTTCTCTGGGCCTCAGTCTCTGG + Intronic
1200163465 X:154020495-154020517 CTTGTCTGGACCGCCACCCCCGG + Intergenic