ID: 1045098983

View in Genome Browser
Species Human (GRCh38)
Location 8:98825980-98826002
Sequence CGGTGCCGCGGCGGGTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045098970_1045098983 3 Left 1045098970 8:98825954-98825976 CCGCGGCCTGGGTTGGCGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 178
Right 1045098983 8:98825980-98826002 CGGTGCCGCGGCGGGTGGGCGGG No data
1045098962_1045098983 25 Left 1045098962 8:98825932-98825954 CCGCGGCGGGGGGCGGAGCCTGC 0: 1
1: 1
2: 2
3: 41
4: 294
Right 1045098983 8:98825980-98826002 CGGTGCCGCGGCGGGTGGGCGGG No data
1045098974_1045098983 -3 Left 1045098974 8:98825960-98825982 CCTGGGTTGGCGGGCGGGGCCGG 0: 1
1: 1
2: 3
3: 54
4: 484
Right 1045098983 8:98825980-98826002 CGGTGCCGCGGCGGGTGGGCGGG No data
1045098967_1045098983 7 Left 1045098967 8:98825950-98825972 CCTGCCGCGGCCTGGGTTGGCGG 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1045098983 8:98825980-98826002 CGGTGCCGCGGCGGGTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045098983 Original CRISPR CGGTGCCGCGGCGGGTGGGC GGG Intronic
No off target data available for this crispr