ID: 1045105388

View in Genome Browser
Species Human (GRCh38)
Location 8:98887760-98887782
Sequence CAGAGCAAGGAGCAGTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045105383_1045105388 -2 Left 1045105383 8:98887739-98887761 CCGTAGTAGTAGAGATGACCCCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045105388 Original CRISPR CAGAGCAAGGAGCAGTCAGC AGG Intronic
No off target data available for this crispr