ID: 1045108271

View in Genome Browser
Species Human (GRCh38)
Location 8:98915036-98915058
Sequence AGACACCCACCTCAAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045108268_1045108271 26 Left 1045108268 8:98914987-98915009 CCTTAAGCACTGTCTCTGAGCTT 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1045108271 8:98915036-98915058 AGACACCCACCTCAAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045108271 Original CRISPR AGACACCCACCTCAAAGGAA AGG Intronic
No off target data available for this crispr