ID: 1045109610

View in Genome Browser
Species Human (GRCh38)
Location 8:98927804-98927826
Sequence CAGCTCCCACTCTGTGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1165
Summary {0: 1, 1: 0, 2: 3, 3: 94, 4: 1067}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045109610_1045109614 21 Left 1045109610 8:98927804-98927826 CCTAGGCCACAGAGTGGGAGCTG 0: 1
1: 0
2: 3
3: 94
4: 1067
Right 1045109614 8:98927848-98927870 GCCATATATTATGAAAAGAAGGG No data
1045109610_1045109613 20 Left 1045109610 8:98927804-98927826 CCTAGGCCACAGAGTGGGAGCTG 0: 1
1: 0
2: 3
3: 94
4: 1067
Right 1045109613 8:98927847-98927869 GGCCATATATTATGAAAAGAAGG No data
1045109610_1045109612 -1 Left 1045109610 8:98927804-98927826 CCTAGGCCACAGAGTGGGAGCTG 0: 1
1: 0
2: 3
3: 94
4: 1067
Right 1045109612 8:98927826-98927848 GTCTGCAGTAGAAGAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045109610 Original CRISPR CAGCTCCCACTCTGTGGCCT AGG (reversed) Intronic
900132995 1:1097436-1097458 CAGGTCTCTCTCTGTCGCCTGGG + Intronic
900311441 1:2035388-2035410 CATCGCCCACTCTGTGCCCCCGG + Intergenic
900459335 1:2794196-2794218 CAGTTCCCACTATGTTGCCCAGG + Intronic
900535352 1:3174340-3174362 CAGGTCACATTCTGAGGCCTGGG + Intronic
900582245 1:3414995-3415017 GAGCGCCCACGCTGTGTCCTGGG - Intronic
900846321 1:5104859-5104881 CAGCTCTCACTATGTTGCCCAGG + Intergenic
901262461 1:7884325-7884347 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
901299405 1:8188283-8188305 AGGCTCCCACTCTGTTGCCCAGG - Intergenic
901343909 1:8521448-8521470 CAGGTCTCACTTTGTTGCCTGGG - Intronic
901579012 1:10225140-10225162 CCTGTACCACTCTGTGGCCTAGG + Intronic
902082974 1:13833824-13833846 CAGGACCCAATGTGTGGCCTCGG + Intergenic
902136359 1:14309585-14309607 CAGGTCTCACTCTGTGGCCCAGG + Intergenic
902389266 1:16093307-16093329 AAGGTCTCACTCTGTGGCCCGGG + Intergenic
902415035 1:16233514-16233536 CACCTCTTACTCTGTAGCCTTGG - Intronic
902557859 1:17257596-17257618 CAGGTCCCACTCTGGTGTCTGGG - Intronic
902577635 1:17388517-17388539 CATCTCCTACTCTGTGTCCCTGG + Exonic
902599585 1:17531972-17531994 CAGCTCCCACTGGCTCGCCTAGG - Intergenic
902961344 1:19965102-19965124 AAGGTCCCACTCTGTTGCCCAGG - Intergenic
903099803 1:21019044-21019066 CAGGTCTCACTCTGTTGCCCAGG + Intronic
903661547 1:24981700-24981722 CAGTTGCCTCTCTGAGGCCTGGG - Intergenic
903717568 1:25379867-25379889 CAGGTCTCACTATGTTGCCTAGG + Intronic
903809972 1:26029719-26029741 CAGTTCCCACCCTGTGGGCAGGG - Intronic
903866350 1:26401219-26401241 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
904022119 1:27474924-27474946 AAGATCCCACTCTGTCACCTAGG - Intronic
904253088 1:29238283-29238305 CACATCCCACCCTGAGGCCTGGG + Intronic
904666300 1:32124345-32124367 CAGGTCTCACTCTGTTGCCCAGG - Intronic
905034108 1:34905983-34906005 CAGGTCTCGCTCTGTTGCCTGGG - Intronic
905277287 1:36826646-36826668 AAGATCTCACTCTGTTGCCTAGG - Intronic
905379337 1:37549428-37549450 CAGATCTCACTCTGTCGCCCAGG + Intronic
905712631 1:40119515-40119537 CAAACCCCACACTGTGGCCTTGG + Intergenic
905729935 1:40290357-40290379 CAGATCTCACTCTGTCGCCCAGG - Intronic
905785320 1:40751429-40751451 AGGGTCTCACTCTGTGGCCTAGG + Intronic
905841850 1:41187434-41187456 CAAGTCTCACTCTGTCGCCTAGG - Intronic
906090504 1:43175534-43175556 CAGGTCTCACTCTGTTGCCCAGG + Intronic
906230934 1:44163475-44163497 AAGATCTCACTCTGTTGCCTAGG + Intergenic
906424871 1:45703111-45703133 AAGGTCTCACTCTGTGGCCCAGG + Intronic
906721434 1:48008002-48008024 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
907718893 1:56953243-56953265 CAGCTTCCACTTATTGGCCTTGG + Intronic
907940548 1:59083241-59083263 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
908146449 1:61249785-61249807 CAAGTCTCACTCTGTTGCCTAGG - Intronic
908265009 1:62369775-62369797 CAGATCTCACTCTGTTGCCCAGG + Intergenic
908470666 1:64440666-64440688 TAGCTCACAATCTGTGGGCTTGG - Intergenic
908747915 1:67393811-67393833 CAACTCCAACACTGTAGCCTGGG - Intronic
909108692 1:71447067-71447089 CACCTCCTGCTGTGTGGCCTGGG - Intronic
909126097 1:71671923-71671945 CAGCTCTCATTCTATTGCCTAGG + Intronic
909458504 1:75878801-75878823 CAGATCTCACTCTGTCGCCCAGG - Intronic
909702729 1:78545248-78545270 CAGGTTCCACTCTGTTGCCCAGG + Intergenic
910299102 1:85685601-85685623 AAGGTCTCACTCTGTCGCCTGGG + Intronic
910457942 1:87417824-87417846 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
910494730 1:87814088-87814110 AAACTCTCACTCTGTCGCCTAGG - Intergenic
910847337 1:91616186-91616208 CAGATCCCACTCTGTTGCCCAGG + Intergenic
910966889 1:92816818-92816840 GAGATCTCACTCTGTCGCCTAGG + Intergenic
911082284 1:93945196-93945218 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
911481548 1:98448552-98448574 CAGGTCTTACTCTGTTGCCTAGG + Intergenic
911585403 1:99684546-99684568 CAGATCTCACTCTGTTGCCCAGG + Intronic
912488124 1:110045449-110045471 CGGGTCTCACTCTGTGGCCCAGG - Intronic
912543502 1:110434392-110434414 CGACACCCACCCTGTGGCCTGGG - Intergenic
912741120 1:112198602-112198624 GAGCTCTCACTCTGTTGCCTAGG + Intergenic
912873491 1:113331271-113331293 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
913115841 1:115696136-115696158 CTGCTCCCACTCTGCTGGCTTGG + Exonic
913236734 1:116791481-116791503 CAGGTCTCACTATGTTGCCTAGG - Intergenic
913527667 1:119709528-119709550 CAGGTCTCACTCTGTTGCCCAGG + Intronic
914788848 1:150858639-150858661 CAGGTCTCACTCTGTTGCCTGGG + Intronic
914809669 1:151017698-151017720 CAGGTCTCACTCTGTCGCCCAGG - Intronic
915214008 1:154328426-154328448 CAGCTCCTGCTTTCTGGCCTAGG + Intronic
915396008 1:155584643-155584665 AAGCTCTCACTCTGTTGCCCAGG - Intergenic
915407166 1:155669227-155669249 CAGTTCTCACTTTGTTGCCTAGG + Intronic
915419882 1:155771667-155771689 CAGTTCTCACTATGTTGCCTGGG + Intronic
915629949 1:157145504-157145526 AAGGTCCCACTCTGTTGCCCAGG + Intergenic
915840007 1:159205895-159205917 CTGCACCCAGTCTGTGGCCCAGG - Exonic
916045806 1:160999242-160999264 CAGCCCTTTCTCTGTGGCCTTGG - Intronic
916959735 1:169876927-169876949 AAGGTCTCACTCTGTCGCCTAGG - Intronic
917234186 1:172872929-172872951 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
917816432 1:178714596-178714618 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
917999185 1:180475410-180475432 GGGGTCCCACTCTGTGGCCCAGG + Intronic
918199314 1:182252318-182252340 CGGCTCTCACTCTGTAGCCCAGG - Intergenic
918261753 1:182802585-182802607 CAGCTAGCACTCTGTGTTCTTGG + Intronic
918301824 1:183211534-183211556 AAGATCTCACTCTGTGGCCAAGG + Intronic
918349631 1:183641158-183641180 AAGATCTCACTCTGTTGCCTAGG + Intronic
918507348 1:185270681-185270703 CAGGTCTCACTCTGTCGCCCAGG - Intronic
919067276 1:192708659-192708681 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
919236806 1:194856694-194856716 AAGGTCTCACTCTGTTGCCTGGG + Intergenic
919515849 1:198521864-198521886 CAGGTACCAGTCTGTGGCCCAGG - Intergenic
919895922 1:202009943-202009965 CAGCGCCCACTCTGTTGGCAAGG - Exonic
920199973 1:204253806-204253828 AAGATCTCACTCTGTTGCCTAGG - Intronic
920399359 1:205667671-205667693 CAGGTCTCACTCTGTTGCCCAGG - Intronic
920524746 1:206658527-206658549 CAACTTCGACTCTGTGGTCTGGG - Intronic
920551179 1:206862165-206862187 CAGGTCTCACTCTGTCGCCCAGG - Intergenic
920693701 1:208165639-208165661 CAGCTACCCCTATGTGGTCTGGG + Intronic
921641346 1:217558754-217558776 CAGGTCTCACTCTGTTGCCCAGG - Intronic
921713848 1:218398906-218398928 CAGGTCTCACTCTGTTGCCCAGG + Intronic
921757632 1:218878899-218878921 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
922174439 1:223185726-223185748 AAGGTCCCACTCTGTCACCTAGG - Intergenic
922538021 1:226397293-226397315 CAGCTCTCATTCTGTTGCCTAGG - Intronic
922619828 1:226982781-226982803 CTGCCCACTCTCTGTGGCCTCGG + Intronic
923045289 1:230351027-230351049 CAGCTCCCGCTCTGTGCACGTGG + Exonic
923120349 1:230984223-230984245 AAGGTCTCACTCTGTCGCCTAGG - Intronic
923401296 1:233617745-233617767 GAGGTCTCACTCTGTTGCCTAGG - Intronic
923406599 1:233667067-233667089 CAGCTCTCACTCTGTTGCCCAGG + Intronic
923471079 1:234291618-234291640 CAGGTCTCACTCTGTTGCCCAGG + Intronic
923998916 1:239528865-239528887 CAACTCTCACTCTGTTGCCCAGG - Intronic
924013305 1:239691156-239691178 CAGCTCTCACTCTGTGACCATGG - Intronic
924013567 1:239694395-239694417 CTGCTTCCACACAGTGGCCTTGG + Intronic
924099627 1:240590001-240590023 CACCTCCCACCATGTGTCCTGGG - Intronic
924234204 1:241987114-241987136 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
924305390 1:242683073-242683095 AAGCTCTCACTCTGTTGCCCAGG - Intergenic
924541844 1:244988206-244988228 CGGGTCCCACTATGTTGCCTAGG + Intronic
1062939108 10:1408786-1408808 CAGCTACCAGTGTGTGGCCGTGG - Intronic
1063130155 10:3171467-3171489 CAGATCTCACTCTGTTGCCCAGG + Intronic
1063174060 10:3535814-3535836 CAGCACCTTCTCAGTGGCCTGGG + Intergenic
1063423231 10:5930773-5930795 AGGCTCTCACTCTGTTGCCTAGG + Intronic
1064056656 10:12103539-12103561 CAGGTCCTCCTCTGTTGCCTAGG + Intronic
1064276064 10:13906076-13906098 CAGCCCCCAGTCTGGGACCTTGG + Intronic
1064276923 10:13914986-13915008 CAGGTCCCACTCTGTTGCCCAGG - Intronic
1064589297 10:16872212-16872234 TAGCTCTCACTCTGTCGCCCAGG - Intronic
1064598203 10:16967438-16967460 CAGCTCTCAATCTGTGGACACGG - Intronic
1064613396 10:17127289-17127311 AAGGTCCCACTCTGTTGCCTGGG + Intronic
1064988279 10:21232711-21232733 CAGGTACCAGTCAGTGGCCTGGG + Intergenic
1065001092 10:21338242-21338264 GAGGTCTCACTCTGTTGCCTAGG + Intergenic
1065085939 10:22176499-22176521 CAGATACCAGTCTGTGGCCCGGG + Intergenic
1065177673 10:23095385-23095407 CTCCTCCCACTATGTGCCCTGGG - Intergenic
1065374141 10:25019446-25019468 AGGCTCCCACTCTGTTGCCCAGG - Intronic
1065830389 10:29609311-29609333 CAGCTCCAGCTCTGAGGTCTGGG - Intronic
1065888495 10:30100405-30100427 CAGATCTCACTCTGTCGCCCAGG + Intronic
1065916226 10:30356663-30356685 CAGGTCTCACTATGTTGCCTAGG - Intronic
1065962506 10:30745344-30745366 CAGGTCTCACTCTGTCGCCCAGG + Intergenic
1066022039 10:31313442-31313464 CAGGTCTCACTCTGTTGCCCTGG + Intergenic
1066280601 10:33914002-33914024 CAGCTACCAGTCTGTGGCTGGGG + Intergenic
1066293815 10:34036902-34036924 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1066577753 10:36845295-36845317 CGAGTCTCACTCTGTGGCCTAGG + Intergenic
1067107760 10:43377066-43377088 CAGCTCCCAATCTGAGGCCAGGG + Intergenic
1067199679 10:44156558-44156580 CACCTCCTGCTGTGTGGCCTGGG + Intergenic
1067283995 10:44894410-44894432 CAGGTCCCTCTCAGTGCCCTGGG + Intergenic
1067565608 10:47334563-47334585 CAGCACCCACTATGAGGCCATGG - Intergenic
1068289555 10:54984809-54984831 AAGATCTCACTCTGTGGCCCAGG - Intronic
1068789228 10:61009099-61009121 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1068794315 10:61061445-61061467 ACGGTCTCACTCTGTGGCCTAGG + Intergenic
1069003459 10:63291974-63291996 AGGGTCCCACTCTGTTGCCTAGG + Intronic
1069391068 10:67935650-67935672 CAACTGCCCCTCTCTGGCCTGGG - Intronic
1069396467 10:67994751-67994773 CAGGTCTCACTCTGTCGCCCGGG + Intronic
1069462319 10:68607456-68607478 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1069514304 10:69065499-69065521 CAGCTGGCCCTCTGGGGCCTTGG + Intergenic
1069594601 10:69662668-69662690 CCGCTTCCACACTGTAGCCTTGG + Intergenic
1069754833 10:70767553-70767575 CATGTTCCACTCTGTGGCCCAGG - Intergenic
1070097330 10:73350784-73350806 CAGGTCTCACTCTGTCACCTGGG + Intronic
1070246832 10:74739958-74739980 CAGTTCTCACTCTGTCGCCCAGG - Intergenic
1070361966 10:75699173-75699195 CAAGTCTCACTCTGTCGCCTAGG - Intronic
1070452530 10:76576317-76576339 CAGCTCCCACCTTGTGACCTGGG - Intergenic
1070756199 10:78994848-78994870 TAGGTCCCACTATGTTGCCTAGG - Intergenic
1070797939 10:79227977-79227999 CAGCACCCTGTCTGTGCCCTGGG + Intronic
1071388551 10:85146570-85146592 CAGATCTCACTATGTTGCCTAGG - Intergenic
1071496146 10:86168883-86168905 CAGCTCATACTCTGTGCCCAGGG - Intronic
1071550006 10:86559648-86559670 AAGCTCCACCTCTGTGGCTTTGG + Intergenic
1071717116 10:88108221-88108243 AAGCTCCTATTCTGAGGCCTGGG - Intergenic
1071798064 10:89027124-89027146 CAGATCTCACTCTGTTGCCCAGG - Intergenic
1072106971 10:92283750-92283772 AAGGTCTCACTCTGTGGCCCAGG + Intronic
1072124293 10:92431696-92431718 CAGTTCTCACTCTGTCGCCCAGG + Intergenic
1072155703 10:92721750-92721772 CAGGTCTCACTCTGTCGCCCAGG - Intergenic
1072259591 10:93656593-93656615 CAGGTCTCACTCTGTCACCTGGG + Intronic
1072261755 10:93682777-93682799 AAGGTCTCACTCTGTTGCCTAGG - Intronic
1072321692 10:94256296-94256318 AAGCTCTCACTCTGTTGCCTAGG - Intronic
1072557498 10:96532182-96532204 GAGGTCTCACTCTGTGGCCCAGG - Intronic
1072721478 10:97783622-97783644 CAAGTCTCACTCTGTTGCCTAGG + Intergenic
1072852176 10:98907442-98907464 CAGGTCTCACTATGTTGCCTAGG - Intronic
1072884217 10:99259698-99259720 CTGATACCAGTCTGTGGCCTGGG - Intergenic
1073396729 10:103224099-103224121 AAAGTCCCACTCTGTCGCCTAGG + Intergenic
1073478451 10:103770232-103770254 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1074052709 10:109894505-109894527 AAGGTCTCACTCTGTTGCCTAGG - Intronic
1074065816 10:110012788-110012810 CAGCTCTCACTATGTTGCCCAGG + Intronic
1074485029 10:113868012-113868034 AAGGTCTCACTCTGTTGCCTGGG + Intronic
1075038323 10:119087744-119087766 CTCCTCCCACTCTGTAGTCTGGG + Intergenic
1075063746 10:119274833-119274855 CACCTCTCACTGGGTGGCCTGGG + Intronic
1075138051 10:119804745-119804767 CAGGTCTCACTCTGTCGCCCAGG + Intronic
1075422685 10:122314310-122314332 CAGGTCCCACTATGTTGCCCAGG - Intronic
1075606468 10:123814997-123815019 GAGGTCCCACTCTGTAGCCCAGG - Intronic
1075726655 10:124613996-124614018 CAGTTCTCACTGTGTGGCATGGG - Exonic
1075728582 10:124623177-124623199 CAGCCCCCACTCTGGGCACTAGG - Exonic
1075814821 10:125256832-125256854 TAGGTCTCACTCTGTGGCCCAGG + Intergenic
1075887074 10:125909716-125909738 CAGGTCTCACTATGTTGCCTGGG + Intronic
1075987859 10:126803553-126803575 CAGCTCCCACCCCATGGCCCAGG - Intergenic
1076041479 10:127253299-127253321 AAATTCCCACTCTGTGGCTTTGG + Intronic
1076292030 10:129352872-129352894 CAGCAGCCTCTGTGTGGCCTAGG - Intergenic
1076399621 10:130173051-130173073 CAGCCCCCACTGTATGGCCCAGG - Intronic
1076569715 10:131424765-131424787 CACCTCCTGCTGTGTGGCCTGGG + Intergenic
1076574450 10:131454413-131454435 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1076651590 10:131992856-131992878 CAGGTCTCGCTCTGTTGCCTAGG - Intergenic
1076752327 10:132549759-132549781 CAGCCCCCACTCTCTGCCCCTGG + Intronic
1076846937 10:133073911-133073933 CAGGTCTCACTCTGTTGCCCTGG + Intronic
1077030803 11:465914-465936 AAGGTCTCACTCTGTCGCCTAGG - Intronic
1077070890 11:671797-671819 AAGGTCTCACTCTGTTGCCTAGG - Intronic
1077147416 11:1052362-1052384 CTGCCCCCACGCTGTGGCCATGG + Intergenic
1077193330 11:1265471-1265493 CAGCTCCTCCCCTGTGGCTTTGG + Intergenic
1077735983 11:4791473-4791495 AAGCTCCCACTGTGTACCCTAGG + Intronic
1078469721 11:11577320-11577342 CAGGTTCCATTCTGGGGCCTGGG - Intronic
1078744434 11:14097752-14097774 GAGGTCTCACTCTGTTGCCTGGG - Intronic
1078914859 11:15769695-15769717 CAGCTCCCCCTGTGTAGCATGGG + Intergenic
1079067199 11:17305645-17305667 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1079200392 11:18372489-18372511 TAGGTCTCACTCTGTGGCCCAGG + Intergenic
1079338753 11:19594824-19594846 CAGTTCCTACTTTGTGGACTTGG + Intronic
1080504365 11:32897876-32897898 CAACTCCCACCATCTGGCCTGGG - Intronic
1080651547 11:34226550-34226572 ATGGTCCTACTCTGTGGCCTTGG - Intronic
1080973267 11:37303816-37303838 CAGCTCCAGCCCTGTGGCTTTGG + Intergenic
1081021293 11:37950624-37950646 CGTGTCTCACTCTGTGGCCTAGG - Intergenic
1081303748 11:41485588-41485610 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1082957553 11:58886189-58886211 AGGATCCCACTCTGTTGCCTAGG - Intronic
1082960228 11:58912774-58912796 CAGCTCCCACTTTAGGGACTGGG + Intronic
1083359511 11:62096290-62096312 CAGGTCTCACTCTGTCGCCCAGG - Intergenic
1083560344 11:63668820-63668842 AAGGTCTCACTCTGTTGCCTAGG + Intronic
1084469486 11:69348729-69348751 CAGCTCCCACTCTGGTGCATGGG + Intronic
1084513616 11:69622420-69622442 AAGGTCCCACTCTGTCGCCCAGG + Intergenic
1084590945 11:70089910-70089932 CAGCTCCCAGAGAGTGGCCTCGG - Intronic
1084682912 11:70677512-70677534 CAGCCCCCATGCTGTGGCCAAGG - Intronic
1085505894 11:77058677-77058699 AAGCTTTCACTCTGTGGCCCAGG - Intergenic
1085593895 11:77790844-77790866 CAGCTCCGCCCCTGTGGCTTTGG + Intronic
1085676214 11:78521362-78521384 TAGGTCCCACTATGTTGCCTAGG + Intronic
1085713607 11:78852655-78852677 CAGGTCTCACTCTGTTGCCTGGG - Intronic
1085893751 11:80611952-80611974 TAAGTCCCACTCTGTTGCCTAGG - Intergenic
1086519181 11:87650707-87650729 CAGCTCTGACCCTGTGGCTTTGG + Intergenic
1087176779 11:95103731-95103753 CAGTTCCCCATCTGTGGCATGGG + Intronic
1087360128 11:97147844-97147866 CAGCTTTCATTCTGTGGCCATGG - Intergenic
1087592203 11:100204499-100204521 AGGCTCTCACTCTGTCGCCTAGG + Intronic
1088276804 11:108096068-108096090 GAGTTCTCACTCTGTTGCCTGGG - Intronic
1088539914 11:110902788-110902810 GATCTCTGACTCTGTGGCCTTGG + Intergenic
1088602304 11:111491707-111491729 CAGGTCTCACTCTGTCACCTAGG - Intronic
1088887571 11:114019842-114019864 CACCTCCCACTGTGTGGCCAAGG + Intergenic
1088922543 11:114271691-114271713 CAGCATCCACTCAGTGGTCTGGG + Intronic
1088925527 11:114297505-114297527 TAGATCTCACTCTGTTGCCTAGG + Intronic
1089044322 11:115486374-115486396 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1089281423 11:117377358-117377380 CACCCCCTGCTCTGTGGCCTGGG + Intronic
1089716454 11:120364841-120364863 CAAGTCCCACTTTGTCGCCTAGG + Intronic
1089732202 11:120526225-120526247 CAGGTCTCACTCTGTCGCCCAGG + Intronic
1090046317 11:123337550-123337572 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1090189803 11:124760375-124760397 CGGCTCCCTCACTCTGGCCTCGG - Intronic
1091238956 11:134039794-134039816 CAGCTCACACTCTCTGGCTACGG - Intergenic
1091524514 12:1284839-1284861 GAAGTCTCACTCTGTGGCCTAGG + Intronic
1091572731 12:1703542-1703564 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1091987553 12:4924525-4924547 GAGGTCTCACTCTGTTGCCTAGG - Intronic
1092082218 12:5725665-5725687 CAGCTCCCACTGGGTGGTCCTGG + Intronic
1092085878 12:5759436-5759458 CAGGTACCAGTCTGTGGTCTGGG - Intronic
1092535885 12:9386672-9386694 CAGGTCTCACTGTGTTGCCTAGG + Intergenic
1092630309 12:10369648-10369670 CACCCTGCACTCTGTGGCCTTGG - Intergenic
1092862372 12:12729891-12729913 CAGGTCTCACTCTGTTACCTAGG + Intronic
1092882362 12:12897632-12897654 CATGTCTCACTCTGTTGCCTAGG + Intronic
1092954070 12:13533229-13533251 CACTTCTCACTGTGTGGCCTTGG + Intergenic
1093168205 12:15829529-15829551 CCGGTACCAATCTGTGGCCTAGG + Intronic
1093433469 12:19109164-19109186 GAGGTCTCACTCTGTCGCCTAGG + Intergenic
1093488948 12:19683086-19683108 CAGGTCTTACTCTGTTGCCTAGG + Intronic
1094191954 12:27707095-27707117 CAGGTCTCACTCTGTCGCCCAGG + Intergenic
1094552667 12:31467593-31467615 AAGGTCTCACTCTGTTGCCTAGG - Intronic
1094639844 12:32263107-32263129 CGGCTCTCACTCTGTTGCCCAGG - Intronic
1094651742 12:32385207-32385229 GAGGTCCCACTATGTTGCCTAGG + Intergenic
1095220504 12:39608140-39608162 GAGGTCTCACTCTGTGGCCCAGG - Intronic
1095350381 12:41203676-41203698 GAGCTCTTACTGTGTGGCCTTGG - Intronic
1095394016 12:41742419-41742441 CAGTTACCAGTCTATGGCCTGGG + Intergenic
1095905077 12:47369221-47369243 CAACTCCCCCACTGAGGCCTAGG + Intergenic
1096601712 12:52734459-52734481 CATCTCCCACACTGAGGCCTGGG + Intergenic
1096773771 12:53952006-53952028 CAGCTCCCAGTCTGGGTCCCCGG - Intergenic
1096853282 12:54457469-54457491 CAGGTCTCACTATGTTGCCTAGG + Intronic
1097286914 12:57885097-57885119 CTGCTGTCATTCTGTGGCCTAGG + Intergenic
1097678710 12:62629502-62629524 AAGCACCCACTGGGTGGCCTGGG + Intergenic
1097727905 12:63095546-63095568 CAGATCCCACTCTGTCACCCAGG + Intergenic
1098125064 12:67282581-67282603 AAGGTCTCACTCTGTGGCCCAGG + Intronic
1098176454 12:67797195-67797217 CAGCTGCCACTCTCTGGCAAGGG - Intergenic
1098334874 12:69393247-69393269 CAGGTCTCACTATGTGACCTAGG - Intergenic
1098671338 12:73234743-73234765 CAGCTTCCACTCTGGGCACTGGG + Intergenic
1098756498 12:74370226-74370248 AAGCTCTTACTCTGTTGCCTAGG - Intergenic
1099154572 12:79158458-79158480 CACCTCCTGCTGTGTGGCCTTGG + Intronic
1099452172 12:82820901-82820923 AAGGTCTCACTCTGTTGCCTAGG + Intronic
1100473889 12:94917951-94917973 GAGATCCCACTATGTTGCCTAGG - Intronic
1100589859 12:96016573-96016595 AAGGTCTCACTCTGTGGCCCAGG - Intronic
1100640533 12:96478320-96478342 AAGCTCTCACTCTGTTGCCCAGG + Intergenic
1100820837 12:98428103-98428125 AAGCTCTCACTCTGTTGCCCAGG - Intergenic
1100970282 12:100062768-100062790 AAGATCTCACTCTGTTGCCTGGG - Intronic
1101133066 12:101709362-101709384 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1101591859 12:106131897-106131919 CCCCTCCTACTCTGAGGCCTGGG + Intronic
1101604802 12:106239912-106239934 CATGTCCCACTCTCTGGACTTGG + Exonic
1101651277 12:106679426-106679448 GAGCCCCCACTCTGTTGCCCAGG - Intronic
1101858119 12:108461074-108461096 CAGCACCCACTCTGCAGCCAAGG + Intergenic
1102063376 12:109952322-109952344 CAGCTCACACTCTGGTGCCGAGG + Intronic
1102195621 12:111023222-111023244 CAGGTCTCACTCTGTTGCCTAGG - Intergenic
1102512273 12:113423714-113423736 AAGGTCTCACTCTGTTGCCTGGG - Intronic
1102563277 12:113777935-113777957 CAGATCCCAGCCTTTGGCCTAGG - Intergenic
1102598080 12:114008139-114008161 CAGATCTCACTCTGTAGCCCAGG + Intergenic
1102786728 12:115611116-115611138 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1103213647 12:119185179-119185201 CAGATCTCACTCTGTTGCCCAGG + Intronic
1103812295 12:123625279-123625301 CAGATCTCACTCTGTTGCCCAGG + Intronic
1103942907 12:124510602-124510624 CAGCTCACCCACTGTGTCCTGGG + Intronic
1104048174 12:125178164-125178186 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1105346194 13:19574684-19574706 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1105544777 13:21343414-21343436 CAGCTCCTCCTCTGTGAACTGGG - Intergenic
1105817498 13:24050573-24050595 CAGCTGCCATGCTGTGTCCTGGG - Intronic
1106105737 13:26732022-26732044 GAGGTCCCAATCTGTTGCCTGGG + Intergenic
1106314195 13:28578953-28578975 CACCTCCCACACTGTTGCATTGG - Intergenic
1106545437 13:30727077-30727099 AAGGTCTCACTCTGTGGCCCAGG + Intronic
1106679172 13:31992658-31992680 CAGGTCTCTCTCTGTTGCCTAGG + Intergenic
1106791410 13:33158596-33158618 CAGCTCCATCTCTGTGTCTTTGG + Intronic
1107106185 13:36645341-36645363 TTCCTCCTACTCTGTGGCCTTGG - Intergenic
1107203726 13:37755288-37755310 AGGGTCTCACTCTGTGGCCTAGG + Intronic
1107451055 13:40509737-40509759 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1107500052 13:40964558-40964580 CAGCTCTCCCTCTGTCACCTAGG + Intronic
1107537799 13:41352627-41352649 CAAGTCTCACTCTGTTGCCTAGG - Intronic
1107862501 13:44674272-44674294 AGGCTCTCACTCTGTCGCCTAGG + Intergenic
1108005516 13:45942130-45942152 CAGCCCCATCACTGTGGCCTTGG + Intergenic
1108025093 13:46169463-46169485 CAGATCTCACTATGTTGCCTAGG + Intronic
1108264751 13:48695439-48695461 CAGGTCTCACTATGTTGCCTAGG + Intronic
1108272193 13:48772195-48772217 CAGCTTCCTCTCTGTGGTCTTGG - Intergenic
1108363808 13:49691202-49691224 CCGCTCCCACTCTCTGGGATGGG + Intronic
1109119405 13:58435164-58435186 CAGATGCAACCCTGTGGCCTGGG - Intergenic
1109719662 13:66259871-66259893 CTGCACCATCTCTGTGGCCTTGG - Intergenic
1109768386 13:66935245-66935267 GAGATCCCACTGTTTGGCCTAGG + Intronic
1110105431 13:71669218-71669240 CAGCTCCTGCTGTGTGGCCCAGG - Intronic
1110321856 13:74169605-74169627 AAGCTACCACTCTTTGCCCTTGG + Intergenic
1110416687 13:75261018-75261040 TCGCTCTCACTCTGTTGCCTAGG - Intergenic
1110482419 13:75995086-75995108 CTGCTACCAATCTGTGGCCCAGG + Intergenic
1110598733 13:77347714-77347736 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1111244530 13:85518359-85518381 AAGGTCTCACTCTGTGGCCCAGG - Intergenic
1111952415 13:94719899-94719921 AAGGTCTCACTCTGTGGCCTGGG + Intergenic
1112026138 13:95413105-95413127 GAGGTCTCACTCTGTTGCCTAGG + Intergenic
1112464818 13:99634870-99634892 CAGATCGCGCTCTCTGGCCTTGG + Intronic
1112609262 13:100939936-100939958 CAGATCTCACTCTGTCACCTAGG - Intergenic
1112616234 13:101008608-101008630 GAGGTCCCACTATGTTGCCTAGG + Intergenic
1112751706 13:102589954-102589976 CATCTCCCCATCTCTGGCCTGGG + Intergenic
1112904793 13:104403968-104403990 AAGGTCCCACTCTGTTGCCCAGG + Intergenic
1112918387 13:104578943-104578965 CAGATCTCACTCTGTTGCCCAGG - Intergenic
1114303115 14:21396020-21396042 CAGGTCTCACTCTGTCGCCCAGG + Intronic
1114671767 14:24415370-24415392 CAGCCCCTATGCTGTGGCCTGGG + Exonic
1114729178 14:24972923-24972945 GAGTTCTCACTCTGTTGCCTAGG - Intronic
1114941433 14:27615918-27615940 AAGGTCCCACTCTGTCACCTAGG + Intergenic
1115340676 14:32290542-32290564 CAGGTCTCACTCTGTTGCCAAGG - Intergenic
1115991475 14:39154951-39154973 GAGCTCTCACTCTGTTGTCTAGG + Intronic
1116018984 14:39439298-39439320 CAGGTCTCACTCTGTTGCCCTGG + Intergenic
1116658477 14:47678112-47678134 AAGTTGCCACTTTGTGGCCTAGG - Intergenic
1117008810 14:51449487-51449509 CAGCTCCTTCTTTGTGGCTTTGG - Intergenic
1117073815 14:52080652-52080674 AAGCTCTCACTCTGTGGCCCAGG - Intergenic
1117246858 14:53895292-53895314 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1118401808 14:65386476-65386498 GAGGTCTCACTCTGTGGCCCAGG - Intergenic
1118436133 14:65772313-65772335 CTGCTCCTCCTCTGTGGCCTGGG + Intergenic
1118714457 14:68549062-68549084 CAGCTCCCACTCTGACTCCCAGG - Intronic
1118779705 14:68999262-68999284 GAGGTCTCGCTCTGTGGCCTAGG + Intergenic
1119020559 14:71108614-71108636 CAGCTCTCACTCTGTGCAGTCGG + Exonic
1119530605 14:75358061-75358083 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1119555616 14:75550152-75550174 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1119634660 14:76264180-76264202 CTGCTGCCACTGTTTGGCCTGGG - Intergenic
1119661780 14:76457238-76457260 CAGCATCCACTCTGAGGTCTAGG + Intronic
1119922236 14:78457062-78457084 CTCCTCCCACTCTGTGGTCCAGG + Intronic
1120105001 14:80484000-80484022 AGGGTCCCACTCTGTTGCCTAGG + Intronic
1120932859 14:89866342-89866364 CAGCTTCTACTGTGTGGCCCTGG - Intronic
1121016776 14:90553696-90553718 ACGCTCCCTCTCTGGGGCCTTGG + Intronic
1121087664 14:91158853-91158875 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1121375714 14:93408664-93408686 AAGATCTCACTCTGTTGCCTAGG - Intronic
1121482759 14:94291361-94291383 TAGCTCCCACACTGCAGCCTAGG - Intronic
1121897401 14:97661352-97661374 CAGCTTCCCTTCTGTGGCCCGGG - Intergenic
1122095683 14:99369558-99369580 CAGGTCTCGCTCTGTCGCCTAGG - Intergenic
1122217411 14:100213554-100213576 CAAGTCTCACTCTGTCGCCTAGG + Intergenic
1122267687 14:100554320-100554342 CCGCTCCCACCCTGTGCCCCTGG + Intronic
1122331240 14:100915981-100916003 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1122466573 14:101937931-101937953 AAGTTCTCACTCTGTTGCCTAGG - Intergenic
1122493221 14:102134123-102134145 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1122566018 14:102656799-102656821 CAGGTCTCACTCTGTCGCCCAGG + Intronic
1122700325 14:103584061-103584083 CAGGTCTCACTCTGTCGCCCAGG + Intronic
1122977942 14:105178635-105178657 CATCTGCCACTCTGAGGCCCAGG + Intronic
1122984031 14:105203979-105204001 CACTCCCCACTCTGTGGCCGAGG + Intergenic
1123000766 14:105292910-105292932 CAGCTCCTCCGCAGTGGCCTGGG - Intronic
1123014663 14:105367974-105367996 CTGCCCCCACTCTGTGTCCAGGG + Intronic
1202871044 14_GL000225v1_random:164264-164286 CAGGTCTCACTATGTTGCCTGGG - Intergenic
1123436664 15:20259623-20259645 CAAGTCTCACTCTGTTGCCTAGG + Intergenic
1123688806 15:22820169-22820191 CACCTCCCACTCTGTTGCCCAGG - Intronic
1124017379 15:25888866-25888888 CAGGTCGCACTGTGTGGCTTAGG + Intergenic
1124236566 15:27994118-27994140 CACCTCCCACTGTGCGGCCCTGG - Intronic
1124944041 15:34246670-34246692 CAGGTCTCACTCTGTTGCCAAGG + Intronic
1125168302 15:36737140-36737162 CGGGTCTCACTCTGTTGCCTAGG - Intronic
1125453744 15:39836067-39836089 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1125480689 15:40077613-40077635 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1125668134 15:41448908-41448930 CAGCTCTCACTCTGTCACCCAGG + Intronic
1125840268 15:42793939-42793961 CGGGTCCCACTCTGTTGCATAGG + Intronic
1126030592 15:44493772-44493794 CAGGTCTCACTTTGTTGCCTAGG - Intronic
1126045924 15:44639674-44639696 CAGGTCTCACTCTGTCACCTAGG - Intronic
1126819674 15:52489797-52489819 CAGGTCTCACTATGTTGCCTAGG - Intronic
1126840389 15:52711939-52711961 CAGGTCTCACTCTGTCACCTAGG + Intergenic
1127248436 15:57204242-57204264 AAGGTCTCACTATGTGGCCTAGG - Intronic
1127371789 15:58348353-58348375 AAGCTCCCTGTCTCTGGCCTTGG + Intronic
1127878688 15:63136065-63136087 AAGATCTCACTCTGTTGCCTAGG + Intronic
1127952280 15:63821228-63821250 GAGGTCTCACTCTGTTGCCTAGG - Intronic
1127986535 15:64076748-64076770 CAGGTCTTACTCTGTCGCCTAGG + Intronic
1128114218 15:65095206-65095228 CTGCTCCCTGTCTATGGCCTTGG + Intronic
1128431316 15:67597141-67597163 CAGATCTCACACTGTGGCCCAGG - Intronic
1128738131 15:70065136-70065158 CGGCTACCACCCTGTGGCCTGGG + Intronic
1128755661 15:70182016-70182038 CAGTTCCAGCTGTGTGGCCTTGG - Intergenic
1128842378 15:70860438-70860460 GAGGTCTCACTCTGTCGCCTAGG + Intronic
1128999035 15:72318218-72318240 CAGCTTCCACCCTTTGGGCTGGG - Intronic
1129245915 15:74278544-74278566 CATCTCCCACCTTCTGGCCTTGG + Intronic
1129409825 15:75343874-75343896 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1129697905 15:77751063-77751085 CATCTCCCTCTCTGTGTCCAGGG + Intronic
1130023305 15:80249142-80249164 AAGTTCTCACTCTGTTGCCTAGG + Intergenic
1130389236 15:83440539-83440561 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1130550999 15:84889878-84889900 CAGGTCTCACTCTGTTGCCTGGG + Intronic
1131019474 15:89086438-89086460 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1131034784 15:89215020-89215042 TGGCTCCCACCCTGTGGGCTGGG - Intronic
1131065508 15:89432881-89432903 CTGCTCCCTCTCTCTGGCCTAGG + Intergenic
1131233812 15:90679549-90679571 CAGATCTCACTCTGTTGCCCAGG + Intergenic
1131479933 15:92772113-92772135 AAGGTCCCACTATGTTGCCTGGG + Intronic
1131509923 15:93044300-93044322 CAGCTGCCCGTCTCTGGCCTGGG - Intronic
1131512277 15:93056001-93056023 CAGATCCCACTCTGTGGCCCTGG - Intronic
1131543513 15:93296166-93296188 CAGGTCTCACTCTGTCGCCCAGG - Intergenic
1132002158 15:98191317-98191339 CAGATCTCACTCTGTTGCCCAGG + Intergenic
1132571131 16:644629-644651 CAGGTCTCACTATGTGGCCCAGG + Intronic
1132854034 16:2036893-2036915 CCGCACCCACCCTGTGCCCTGGG - Intronic
1132881220 16:2162529-2162551 CAGCTCCGCCACTTTGGCCTGGG + Intronic
1133001446 16:2853484-2853506 CAGCTCCTACTCTGCCGCCGGGG - Intronic
1133011393 16:2913899-2913921 CAGGTCTCACTATGTTGCCTAGG + Intronic
1133249708 16:4472999-4473021 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1133810811 16:9159805-9159827 AAGATCTCACTCTGTGGCCCAGG + Intergenic
1134027753 16:10967423-10967445 CAGGTCTCACCCTGTCGCCTAGG + Intronic
1134195810 16:12158102-12158124 CAGTTCTCACTCTGTTGCCCAGG + Intronic
1134619293 16:15675460-15675482 GTGGTCTCACTCTGTGGCCTGGG + Intronic
1134635914 16:15791697-15791719 AAGATCTCACTCTGTGGCCCAGG + Intronic
1134679456 16:16114045-16114067 CTGCTGCCAATCTGTGGCCCCGG + Intronic
1134690232 16:16186366-16186388 CTGGTACCAGTCTGTGGCCTGGG - Intronic
1134759767 16:16703878-16703900 CAGGTCTCACTGTGTTGCCTGGG + Intergenic
1134827685 16:17297695-17297717 AAGGTCTCACTCTGTGGCCTAGG - Intronic
1134986304 16:18655327-18655349 CAGGTCTCACTGTGTTGCCTGGG - Intergenic
1135194681 16:20384685-20384707 CAGCTTCAACTCCGGGGCCTTGG + Exonic
1135734314 16:24918633-24918655 CAGATCTCACTCTGTGGCCCAGG - Intergenic
1135950787 16:26912141-26912163 AGGCTCTCACTCTGTGGCCCAGG - Intergenic
1136032892 16:27516342-27516364 CAGCACCCACTCTGGGTCATGGG - Intronic
1136035287 16:27534654-27534676 CAGCTGCCACCCTGTGTTCTTGG + Intronic
1136253933 16:29025596-29025618 GGGCTCCCACCCTGTGGCCTGGG + Intergenic
1136383545 16:29908726-29908748 AAGATCTCACTCTGTTGCCTAGG + Intronic
1136847904 16:33591230-33591252 CAAGTCTCACTCTGTTGCCTAGG - Intergenic
1137234815 16:46607326-46607348 AAGCTCTCACTCTGTTGCCCAGG - Intronic
1137263970 16:46853568-46853590 CAGGTCTCACTCTGTGGCCCAGG + Intergenic
1137340151 16:47593412-47593434 AAGATCTCACTCTGTGGCCCAGG - Intronic
1137422589 16:48348518-48348540 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1137572211 16:49574190-49574212 CGGGTCCCACTATGTGGCCCAGG - Intronic
1137871657 16:51955627-51955649 CATCTCTCACTCTGTCGCCCAGG - Intergenic
1138004574 16:53320148-53320170 AAGGTCTCACTCTGTGGCCCAGG - Intronic
1138085495 16:54129825-54129847 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1138136220 16:54525289-54525311 CAGCTCCCAATATGTGTGCTGGG - Intergenic
1138338636 16:56272546-56272568 CAGGTCTCAATCTGTTGCCTGGG - Intronic
1138412772 16:56852977-56852999 AGGCTCCCACTCTGTCACCTAGG + Intergenic
1138458092 16:57132764-57132786 CAGGCCCCACTGTGTGACCTGGG + Intronic
1138762063 16:59556615-59556637 CAGATCTCACTCTGTCACCTGGG - Intergenic
1139275958 16:65727866-65727888 CAGCTGCCATTCAGTGGCCTTGG + Intergenic
1139594826 16:67951453-67951475 CAGCTCCTTCTCTGTGGTCAGGG - Intronic
1139675810 16:68522804-68522826 AAGTTCTCACTCTGTGGCCCAGG + Intergenic
1139765180 16:69222565-69222587 GAAGTCTCACTCTGTGGCCTGGG - Intronic
1140170998 16:72604466-72604488 GAGCTCTCACTCTGTCTCCTAGG - Intergenic
1140204623 16:72923417-72923439 CAGGTCTCACTCTGTCGCCCAGG - Intronic
1140256982 16:73346013-73346035 CAGCTCCCTCATTCTGGCCTGGG - Intergenic
1140524917 16:75614623-75614645 CATCTCCCACTCTGCAGGCTTGG + Intronic
1141750388 16:85954472-85954494 CAAGTCCCTCTCTGTGGCCTGGG - Intergenic
1141757976 16:86005628-86005650 CAGCTCTCACTCTGTTGCCTAGG - Intergenic
1141806852 16:86347643-86347665 AAGCTCCCTCTCTCTGGCCATGG - Intergenic
1141957442 16:87382655-87382677 CAAGTCGCACTCTGTCGCCTAGG + Intronic
1142126963 16:88415058-88415080 CACTTCCCACTGTGTGGCCTTGG + Intergenic
1142355774 16:89601123-89601145 CAGCTCCCGCTGTGTGACCCTGG + Intergenic
1142357914 16:89612403-89612425 AGGCTCCCACTCTGCGGCCCAGG + Intergenic
1203109612 16_KI270728v1_random:1439879-1439901 CAAGTCTCACTCTGTTGCCTAGG - Intergenic
1142810073 17:2391826-2391848 GAGGTCGCACTCTGTGGCCCAGG + Intronic
1143103942 17:4519226-4519248 GAGCCCCCGCCCTGTGGCCTTGG - Intronic
1143316594 17:6037673-6037695 CAACTACCAGTCTGTGGCCTCGG - Intronic
1143497256 17:7319290-7319312 CACCTCCCAGAATGTGGCCTGGG + Intronic
1143675068 17:8426564-8426586 CAGCTGCCACTCTGGGGTGTGGG + Intronic
1143823104 17:9580661-9580683 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1144239557 17:13296849-13296871 CAGCTTCAGCTCTGTGACCTTGG - Intergenic
1144598878 17:16595824-16595846 CAAGTCCCACTCTGTTGCCCAGG - Intergenic
1145054852 17:19695455-19695477 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1145098430 17:20052570-20052592 CTGCTCCCAGCCTGTGGTCTAGG - Intronic
1146029659 17:29354602-29354624 CAGATCTCACTGTGTTGCCTAGG + Intergenic
1146666870 17:34711078-34711100 CAGCTTCCTCTCTCTGGTCTTGG - Intergenic
1146848630 17:36202305-36202327 AAGGTCTCACTCTGTGGCCCAGG + Intronic
1147201359 17:38804017-38804039 AAGGTCTCACTCTGTTGCCTAGG - Intronic
1147278151 17:39336087-39336109 AGGCTCTCACTCTGTTGCCTAGG - Intronic
1147334738 17:39720422-39720444 CAAGTCCCACCCTGTGGCTTGGG - Intronic
1147367579 17:39969322-39969344 AAGGTCCCACTCTGTTGCCCAGG - Intronic
1147377265 17:40030056-40030078 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1147562519 17:41517918-41517940 CAGGTTCCACTCTGTCACCTAGG + Intronic
1147684554 17:42279156-42279178 CAGGTCTCACTCTGTCGCCCAGG - Intergenic
1147808819 17:43152074-43152096 CATCACACACTATGTGGCCTTGG - Intergenic
1147874230 17:43609489-43609511 GAGTTCTGACTCTGTGGCCTTGG - Intergenic
1148021071 17:44554193-44554215 GAGGTCTCACTCTGTTGCCTGGG + Intergenic
1148055277 17:44790858-44790880 AAGATCCCACTCTGTTGCCGAGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148956593 17:51358931-51358953 AAGCTCTCACTCTGTTGCCCAGG - Intergenic
1149767540 17:59291956-59291978 CAGATCTCACTCTATTGCCTAGG + Intergenic
1149918773 17:60636717-60636739 GAGGTCTCACTCTGTGCCCTAGG + Intronic
1150705265 17:67481180-67481202 CAGGTCTCGCTCTGTCGCCTAGG - Intronic
1150741340 17:67781266-67781288 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1150849018 17:68686965-68686987 CATCTCCCACTCTCTGGGCCTGG - Intergenic
1151240391 17:72752879-72752901 TAGGTCTCACTCTGTGGCCCGGG + Intronic
1151648616 17:75451370-75451392 CAGGTCTCACTCTGTCGCCCAGG + Intronic
1152292658 17:79449015-79449037 CAGCTCCAACCCAGTGGCCGAGG - Intronic
1152381901 17:79946542-79946564 CAAGTCACACTCTGTGTCCTGGG + Intronic
1152381911 17:79946582-79946604 CAAGTCACACTCTGTGTCCTGGG + Intronic
1152507038 17:80756286-80756308 CAGATGCCACTCTTTGACCTTGG + Intronic
1152937799 17:83150609-83150631 CAGCCCTCACCTTGTGGCCTGGG + Intergenic
1153188496 18:2512411-2512433 CAGGTCCCACTGTGTTGCCCAGG + Intergenic
1153242193 18:3041219-3041241 GGGGTCTCACTCTGTGGCCTAGG - Intergenic
1153508944 18:5831934-5831956 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1153836905 18:8971522-8971544 GAGGTCTCACTCTGTGGCCCAGG + Intergenic
1154104111 18:11505325-11505347 CAGATCTCACTCTGTTGCCCAGG + Intergenic
1154322749 18:13367994-13368016 CAGGTCTCACTCTGTCACCTGGG - Intronic
1154350862 18:13582348-13582370 CAGCTACCATGCTGCGGCCTGGG - Intronic
1155245266 18:23902307-23902329 CAGGTCTCATTCTGTTGCCTAGG - Intronic
1155503913 18:26514522-26514544 AAGGTCTCACTCTGTTGCCTGGG - Intronic
1156299695 18:35825662-35825684 CAGCTCCGCCTCTGCTGCCTAGG + Intergenic
1156354091 18:36326574-36326596 AGGCTCTCACTCTGTTGCCTAGG - Intronic
1156659387 18:39328571-39328593 CAGATCTCACTCTGTTGCCCAGG - Intergenic
1156866118 18:41890558-41890580 AAGCTTTCACTCTGTGGCCCAGG - Intergenic
1157055114 18:44218606-44218628 AAGTTCTCACTCTGTTGCCTAGG - Intergenic
1157623737 18:49031466-49031488 CAGCTCCCACTATGTGGATGGGG - Intergenic
1157852020 18:51063436-51063458 GGGGTCTCACTCTGTGGCCTGGG + Intronic
1157859709 18:51129761-51129783 CAGGTCTCCCTCTGTTGCCTAGG - Intergenic
1158133857 18:54184187-54184209 CCGCTACCCGTCTGTGGCCTGGG - Intronic
1158419800 18:57283090-57283112 CACATCTCACTCTGTGGCCCAGG - Intergenic
1158572501 18:58608930-58608952 AAGGTCCCACTCTGTCGCCCAGG - Intronic
1159270280 18:66140350-66140372 CACCTCCCACACTGTTGCATTGG + Intergenic
1160131799 18:76231818-76231840 CTGCTCACCCTCTGTGGCCTCGG + Intergenic
1160165732 18:76510236-76510258 CAGGTTTCACTCTGTTGCCTAGG - Intergenic
1160559382 18:79746640-79746662 AAGGTCTCACTCTGTTGCCTGGG + Intronic
1160571048 18:79817989-79818011 CAGCACCCACCCTGAGCCCTTGG - Intergenic
1160588130 18:79924009-79924031 CAGGTCCCACTCTGTCACCCAGG - Intronic
1160668892 19:346822-346844 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1160711258 19:552172-552194 CAGTTCCCACTCTGTTGCCCAGG + Intergenic
1160905627 19:1450442-1450464 CAGCTCCCACTCTGGGGAAATGG - Intronic
1161041116 19:2111228-2111250 CAGCCCACACTCTTTGGCATGGG - Intronic
1161082522 19:2318396-2318418 AAGGTCTCACTCTGTGGCCCAGG - Intronic
1161208052 19:3052282-3052304 CAGCTCACCCTCTCTGGGCTAGG + Intergenic
1161395327 19:4042436-4042458 CAGCTCCTCCTCTGTGGATTGGG - Intergenic
1161505467 19:4641113-4641135 CCCCTCCCACTGTGTGGCCTTGG + Intronic
1161531898 19:4794620-4794642 CAGCTCACTCCCTGTGCCCTCGG - Exonic
1161652530 19:5494095-5494117 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1161767393 19:6215131-6215153 AAGCTCCGACGGTGTGGCCTGGG + Intronic
1161779371 19:6280486-6280508 CACGTCTCGCTCTGTGGCCTAGG + Intergenic
1161869591 19:6860024-6860046 GAGGTCTCACTCTGTTGCCTAGG - Intergenic
1161871306 19:6872516-6872538 CAGCTATCAATCTGTCGCCTAGG - Intergenic
1161888500 19:7016142-7016164 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1161945537 19:7433991-7434013 CAGATCTCACTCTGTCGCCCAGG - Intronic
1161992861 19:7694858-7694880 AAGGTCCCACTCTGTTGCCCAGG + Intronic
1162013530 19:7831501-7831523 CAGCGCCCACACTGGAGCCTTGG + Intronic
1162075676 19:8185398-8185420 AAGGTCCCACTCTGTTGCCCAGG - Intronic
1162267185 19:9585148-9585170 CAGATCTCACTCTGTTGCCCAGG + Intergenic
1162302599 19:9852408-9852430 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1162461235 19:10815607-10815629 CAGCTCCTCCTCTGTGCACTGGG - Intronic
1162620328 19:11838040-11838062 GGGCTCTCACTCTGTGGCCCAGG - Intergenic
1162683771 19:12365364-12365386 CAGCTCCCACCCCGCGGCCGAGG + Intronic
1162845814 19:13391703-13391725 CAGGTCTCACTTTGTTGCCTAGG - Intronic
1162946493 19:14047067-14047089 AAGATCCCACTCTGTGGCCCAGG + Intronic
1162971697 19:14184456-14184478 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1163223837 19:15940764-15940786 CAGCTCTCACTGTGTGTCTTTGG - Intergenic
1163627586 19:18399012-18399034 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1163698685 19:18776497-18776519 GTGCTCCCCCACTGTGGCCTGGG + Intronic
1164860427 19:31558276-31558298 CAACTCTCACTCTGTTGCCCAGG - Intergenic
1165040980 19:33067137-33067159 AAGGTCCCACTCTGTCGCCCAGG - Intergenic
1165310271 19:35025613-35025635 CATTACCCACTCTGTGACCTCGG - Intronic
1165332094 19:35145801-35145823 AAGGTCTCACTCTGTCGCCTAGG + Intronic
1165551356 19:36589136-36589158 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1165698057 19:37916050-37916072 CAGTTCTCACTCTGTTGCCCAGG + Intronic
1166001671 19:39881186-39881208 AAGGTCTCACTCTGTGGCCCAGG - Intronic
1166004453 19:39897437-39897459 AAGGTCTCACTCTGTGGCCCAGG - Intronic
1166035061 19:40162029-40162051 CAGATCACACTCTGGGGCCATGG + Intergenic
1166230872 19:41425351-41425373 CACTCCCCACTCTGAGGCCTGGG - Exonic
1166337219 19:42115675-42115697 CAGCTCCCACTCTGCTCCCCCGG + Intronic
1166617873 19:44267377-44267399 CAGGTCTCACTCTGTGACCTAGG + Intronic
1166819492 19:45568769-45568791 CAGCACCGTCTCTGTGGCCCAGG - Intronic
1166854020 19:45773674-45773696 CAGGTCTCACTTTGTTGCCTAGG + Intronic
1166877509 19:45906516-45906538 AAGATCCCACTGTGTTGCCTAGG + Intergenic
1167217290 19:48173065-48173087 CAGGTCCCATGCTGTGGGCTGGG + Intronic
1167247686 19:48383534-48383556 AAGGTCCCACTCTGTAGCCCAGG + Intronic
1167384243 19:49154892-49154914 CATCTCCGACTTTGTGGTCTTGG + Exonic
1167592155 19:50409866-50409888 CAGGGCTCACTCTGTGCCCTGGG + Intronic
1167601482 19:50457556-50457578 CAGCTCAGGCTCTGTGGACTAGG - Intronic
1167740290 19:51320486-51320508 CAGCCCCCACTCCCTGGCCCTGG + Intronic
1167811264 19:51833218-51833240 CCCCTCCTACTCTGTGGCCTGGG + Intergenic
1168219239 19:54948522-54948544 TGGGTCTCACTCTGTGGCCTAGG - Intronic
1168712887 19:58511894-58511916 CTGCTCCTGCTCTGGGGCCTGGG - Exonic
925314091 2:2908063-2908085 AAGCTCCCACACTGGGGCCTGGG - Intergenic
925342382 2:3146443-3146465 CCCCTCTCACTGTGTGGCCTGGG + Intergenic
925819280 2:7783667-7783689 CAGCTCCCAGTCTGGGGCTATGG - Intergenic
925955851 2:8963210-8963232 AGGCTCTCACTCTGTTGCCTAGG - Intronic
925968921 2:9093383-9093405 AAGCTCTCACTCTGTCGCCTAGG - Intergenic
926039805 2:9664061-9664083 CCACTCCCACTCTGTTCCCTGGG + Intergenic
926044891 2:9703259-9703281 CAGTTTCCACTGTGTTGCCTGGG + Intergenic
926657841 2:15428536-15428558 GAGGTCCCACTATGTTGCCTAGG - Intronic
927141660 2:20135172-20135194 CAGCTCCCACCCTGGGGCCATGG + Intergenic
927362758 2:22255667-22255689 CAGGTCTCACTCTGTTTCCTGGG + Intergenic
927975651 2:27336219-27336241 CTGCTCCAGCTCTGGGGCCTTGG - Exonic
928092179 2:28381739-28381761 CACCTCCCTCACTCTGGCCTGGG - Intergenic
928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG + Intergenic
928500089 2:31882116-31882138 AAGGTCTCACTCTGTGGCCCAGG - Intronic
928595658 2:32856701-32856723 AAGCACACACTCTGGGGCCTTGG + Intergenic
928768251 2:34673602-34673624 CAAGTCTCACTCTGTGGCCTAGG - Intergenic
928994373 2:37271518-37271540 CAGTTACCAGTCTGTGGCCTGGG - Intronic
929028535 2:37629071-37629093 CAACTACCATTCTGTGACCTTGG - Intergenic
929095224 2:38257446-38257468 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
929126652 2:38528719-38528741 CACTTCCTACTCTCTGGCCTTGG + Intergenic
929619740 2:43342408-43342430 GAGCTTTCACTGTGTGGCCTGGG + Intronic
929634407 2:43502557-43502579 GAGGTCTCACTCTGTGGCCTAGG - Intronic
929872581 2:45771528-45771550 CAGCACACACTCTGTGGGCCAGG + Intronic
929938169 2:46310120-46310142 CAGCTCCCACTCCATGCACTAGG - Intronic
930103063 2:47617926-47617948 CAGGCCACACTCTTTGGCCTTGG + Intergenic
930408829 2:50997531-50997553 AGGCTCTCACTCTGTGCCCTAGG + Intronic
930649461 2:53950256-53950278 AAGATCTCACTCTGTCGCCTAGG - Intronic
930659445 2:54039316-54039338 AGGGTCCCACTCTGTGGCCCAGG + Intronic
930766579 2:55091223-55091245 CAAATTCCTCTCTGTGGCCTAGG + Intronic
931320519 2:61171113-61171135 CAGATCTCACTCTGTCGCCCAGG - Intergenic
931365495 2:61615390-61615412 CGGGTCCCGCTCTGTTGCCTAGG + Intergenic
931410761 2:62028545-62028567 AGGCTCTCACTCTGTCGCCTAGG - Intronic
932006122 2:67928774-67928796 AGGGTCCCACTCTGTGGCTTAGG - Intergenic
932072723 2:68636981-68637003 CAGATCCTACTATGTTGCCTAGG + Intergenic
932430417 2:71670766-71670788 CAGCACCCATTCTGTGCTCTGGG - Intronic
932444964 2:71774469-71774491 AGGGTCTCACTCTGTGGCCTGGG + Intergenic
932898999 2:75676363-75676385 CAGCTTCCACTCCTTGGTCTTGG + Intronic
933861038 2:86467998-86468020 AAGCTCTCACTCTGTTGCCCAGG - Intronic
933878276 2:86642239-86642261 CAGGTCTCACTATGTTGCCTAGG + Intronic
933976897 2:87519118-87519140 CACCTCTCACTCTGTGACTTTGG + Intergenic
933995500 2:87665520-87665542 AAGGTCTCACTCTGTGGCCCAGG - Intergenic
934761418 2:96858964-96858986 CAGCGCCCACTGTGGGGCCAGGG - Intergenic
935087094 2:99858523-99858545 AAGGTCTCACTCTGTTGCCTGGG - Intronic
935111037 2:100094557-100094579 CACCTCCCACTCTGCAGCCCAGG + Intronic
935140712 2:100350623-100350645 CAGCTCCCACTCAGTCCCCCTGG + Intergenic
935475779 2:103521741-103521763 CAGGTCTCACTATGTTGCCTAGG + Intergenic
936123939 2:109770605-109770627 CACCTCCCACTCTGCAGCCCAGG - Intergenic
936220750 2:110600859-110600881 CACCTCCCACTCTGCAGCCCAGG + Intergenic
936298356 2:111285395-111285417 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
936316920 2:111431686-111431708 CACCTCTCACTCTGTGACTTTGG - Intergenic
936349688 2:111703304-111703326 AGGGTCTCACTCTGTGGCCTGGG - Intergenic
936544332 2:113377764-113377786 CCCCACCCACTCTGTTGCCTGGG + Intergenic
936617583 2:114063658-114063680 CAGATCCCACTGTGTTGCCCAGG - Intergenic
937128767 2:119491179-119491201 CACCTCCCACACTGTGGCAGAGG + Intronic
937227674 2:120379052-120379074 CAGTTCCAACTCCGTGGCCTGGG + Intergenic
937293085 2:120793736-120793758 CAGCTCCCAGACTGTGGCTCAGG - Intronic
937370585 2:121294732-121294754 CAGGTCTCACTATGTTGCCTAGG - Intergenic
937925759 2:127166267-127166289 CAGCTCTCCTTCTGTGGCCCTGG - Intergenic
937979105 2:127602972-127602994 AAGGTCTCACTCTGTCGCCTAGG - Intronic
938050841 2:128169343-128169365 AAGGTCTCACTCTGTGGCCCAGG - Intronic
938092419 2:128442173-128442195 CAGCTCCCACTCTGCGCCCCTGG - Intergenic
938334671 2:130481460-130481482 CTGGTACCAGTCTGTGGCCTGGG - Intronic
938355150 2:130639210-130639232 CTGGTACCAGTCTGTGGCCTGGG + Intronic
938419408 2:131132488-131132510 GAGCTCTCCCTCTGTTGCCTAGG + Intronic
938776028 2:134542470-134542492 CAGGTGACAGTCTGTGGCCTGGG - Intronic
938783387 2:134605149-134605171 CAAGTCTCACTCTGTCGCCTAGG - Intronic
938894431 2:135736311-135736333 CAAGTCTCACTCTGTTGCCTAGG + Intergenic
939914848 2:148026595-148026617 AAGGTCCCGCTCTGTGGCCTAGG - Intronic
940048377 2:149434714-149434736 CAGAACCCTCTCTGTGGCCAGGG + Intronic
940240240 2:151554532-151554554 CAGGTCTCACTCTGTTGCCCTGG - Intronic
940561309 2:155300842-155300864 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
940788160 2:158003737-158003759 AAACTACAACTCTGTGGCCTAGG + Intronic
940910319 2:159204496-159204518 CATCTCCCTCTCTGCAGCCTGGG + Intronic
940943669 2:159592092-159592114 CAGGTCTCACTCTGTTGCCCAGG - Intronic
942037549 2:172025352-172025374 AAGATCTCACTCTGTGGCCCAGG + Intronic
942055996 2:172182769-172182791 GGGCTCTCACTCTGTTGCCTAGG + Intergenic
942738556 2:179146018-179146040 CACCTCCTGCTCTGTGGCCCAGG - Intronic
942977738 2:182039408-182039430 CAGATCTCACTCTGTCTCCTAGG + Intronic
943041670 2:182811963-182811985 CAGGTCTCACTCTGTCACCTAGG + Intergenic
944062576 2:195584635-195584657 GAGGTCTCACTCTGTTGCCTAGG - Intronic
944315946 2:198285945-198285967 CAGCTACCACTCTGGGAGCTAGG + Intronic
944417153 2:199490390-199490412 CAAGTCTCACTCTGTTGCCTAGG + Intergenic
945104964 2:206302033-206302055 TAGGTCTCACTCTGTGGCCCAGG + Intronic
945224782 2:207522458-207522480 CAGTTCCGACTCTGTGACATGGG + Intergenic
945872107 2:215238390-215238412 TAGCTCACACCCTGTGGCTTTGG + Intergenic
946169027 2:217883288-217883310 CAGGTCTCACTCTGTTGCCCAGG + Intronic
946352821 2:219166558-219166580 AAGGTCTCACTCTGTCGCCTGGG + Intronic
947230294 2:227877816-227877838 CACCTCCTGCTGTGTGGCCTGGG + Intronic
947425309 2:229978058-229978080 CAGGTCTCACTCTGTTGCCAAGG - Intronic
947600971 2:231450109-231450131 AAGGTCTCACTCTGTGGCCCAGG - Intergenic
947664957 2:231899677-231899699 CCAGTCTCACTCTGTGGCCTAGG + Intergenic
947665011 2:231899987-231900009 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
947797613 2:232904915-232904937 AAGGTCTCACTCTGTGGCCCAGG - Intronic
948018732 2:234712635-234712657 CAGTTCTCCCTTTGTGGCCTAGG + Intergenic
948435338 2:237949765-237949787 CAGGTCTCACTCTGTCGCCCAGG + Intergenic
948485674 2:238279409-238279431 CATCTGCTACTGTGTGGCCTGGG - Intronic
948653370 2:239462679-239462701 CTGGGCCCACTCTGTGACCTTGG + Intergenic
949081511 2:242104259-242104281 CACCTCCTGCTCTGTGGCCCAGG - Intergenic
1168920981 20:1536087-1536109 CAACTCTCACTCTGTGTCTTTGG - Intronic
1169117082 20:3072644-3072666 CAGCACCCGCTCTGTCCCCTCGG - Intergenic
1170061520 20:12264458-12264480 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1170109787 20:12792688-12792710 AATGTTCCACTCTGTGGCCTAGG - Intergenic
1170648727 20:18219812-18219834 CAGGTCTCACTCTGTGGCCCAGG - Intergenic
1171222814 20:23415938-23415960 GAGCTCTCACTCTGTTGCCTAGG - Intronic
1171757453 20:29124094-29124116 CGGGTCCCACTCTGTCACCTAGG - Intergenic
1172047626 20:32091778-32091800 GAGGTCCCACTATGTGGCCCAGG - Intronic
1172135392 20:32683191-32683213 GAAGTCTCACTCTGTGGCCTAGG - Intergenic
1172316178 20:33956487-33956509 CAGATCTCACTCTGTTGCCCAGG + Intergenic
1172477410 20:35249171-35249193 CAGCTCCAGCTCTGTGACCTTGG + Intronic
1172481155 20:35272259-35272281 AAGGTCTCACTCTGTCGCCTAGG + Intronic
1172599510 20:36174135-36174157 CAGATCTCACTCTGTTGCCCAGG + Intronic
1172623771 20:36335999-36336021 CTGCTCCCACCCTGTGGCCAGGG + Intronic
1172752211 20:37258763-37258785 CGGGTCTCACTCTGTGGCCCAGG + Intronic
1172801233 20:37577630-37577652 CACCTCCTGCTATGTGGCCTGGG - Intergenic
1173206349 20:40997540-40997562 AGGGTCTCACTCTGTGGCCTAGG + Intergenic
1173210306 20:41027436-41027458 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1173481138 20:43400302-43400324 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1173654253 20:44688898-44688920 CGGATCTCACTCTGTCGCCTAGG - Intergenic
1174194532 20:48763712-48763734 CACCTCCCTCACTGAGGCCTGGG - Intronic
1174466006 20:50717990-50718012 GAGGTCTCACTATGTGGCCTAGG + Intergenic
1174662758 20:52228591-52228613 CACCTCCTGCTGTGTGGCCTGGG - Intergenic
1174818764 20:53709728-53709750 CGGCTCTCACTCTGTTGCCCAGG + Intergenic
1174892111 20:54406497-54406519 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1175921558 20:62452757-62452779 CAGATCACCCTCTGGGGCCTCGG + Intergenic
1176022665 20:62970128-62970150 CAGCTCTCACTGTGTTGCCCAGG + Intergenic
1176285485 21:5016875-5016897 CAGCGCCCACTGGGTGGCCCCGG - Intergenic
1176946812 21:14992061-14992083 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1177315688 21:19457919-19457941 AAGATCTCACTCTGTTGCCTAGG - Intergenic
1177525771 21:22288021-22288043 CAGCTCCACCCCTGTGGCTTTGG - Intergenic
1177555959 21:22689148-22689170 AGGGTCTCACTCTGTGGCCTAGG + Intergenic
1177569259 21:22865315-22865337 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1177918677 21:27123779-27123801 CAGCTCTGCCTCTGTGGCTTTGG + Intergenic
1178601960 21:34002231-34002253 TAGGTCTTACTCTGTGGCCTAGG + Intergenic
1178765879 21:35450611-35450633 CAGCTCCACCCCTGTGGCTTTGG + Intronic
1178847111 21:36183061-36183083 CAGCTCCTGCACTCTGGCCTGGG - Intronic
1178868432 21:36350399-36350421 AAGCTCCCACTGTGTTGCCCAGG - Intronic
1179068916 21:38053675-38053697 CAGCTCCAGCTCCATGGCCTGGG - Intronic
1179777285 21:43673606-43673628 GGGGTCCCACTCTGTGGCCCAGG - Intronic
1179871696 21:44246600-44246622 CAGCGCCCACTGGGTGGCCCCGG + Intronic
1180240600 21:46502159-46502181 AAGATCTCACTCTGTGGCCCGGG + Intronic
1181078888 22:20400932-20400954 CAGCTCCCACGCTGTCCCTTGGG - Intronic
1181766961 22:25099068-25099090 CAGCTTCCACTCTCTGGGCAAGG - Intronic
1181915639 22:26277765-26277787 CAGAGCCCATTCTGTGGCCATGG - Intronic
1182080431 22:27524863-27524885 CACCTCTCACTCTTTGACCTTGG - Intergenic
1182379143 22:29872353-29872375 TACCTCCCACTATGTGGCCCTGG + Intergenic
1182387792 22:29960952-29960974 CTGCTCCCACTCTCTTCCCTAGG + Intronic
1182561982 22:31167199-31167221 AGGGTCTCACTCTGTGGCCTAGG + Intronic
1182632960 22:31701831-31701853 AAGGTCTCACTCTGTGGCCCAGG + Intronic
1183058531 22:35321422-35321444 CGGCTCTCACTCTGTTGCCCAGG + Intronic
1183633706 22:39048247-39048269 CATCCCCATCTCTGTGGCCTGGG + Intronic
1183847435 22:40553886-40553908 CAGCTCTGCCTCTGTGGCTTTGG - Intronic
1183864231 22:40691318-40691340 AAGCTCTCACTCTGTTGCCTAGG - Intergenic
1183884590 22:40867910-40867932 CAGGTCTCACTCTGTCGCCCAGG - Intronic
1184008560 22:41729312-41729334 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1184056553 22:42054860-42054882 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1184213273 22:43049740-43049762 AGGGTCCCACTCTGTGGCCTAGG - Intronic
1184219978 22:43093823-43093845 CAGGTCTCACTATGTTGCCTAGG + Intergenic
1184455649 22:44608244-44608266 CCTCTCCCGCTGTGTGGCCTCGG + Intergenic
1184558092 22:45244219-45244241 CAGGTCTCACTCTGTTGCCTAGG - Intergenic
1184797296 22:46739542-46739564 CAGCTGCCGCTCTGAGGCCTGGG + Intergenic
1185089215 22:48756541-48756563 CAGCTCCAACCCACTGGCCTCGG + Intronic
949890541 3:8730620-8730642 GAGCCCCCTCTCTGAGGCCTGGG - Intronic
949994665 3:9607119-9607141 GAGATCTCACTCTGTGGCCCAGG + Intergenic
950010970 3:9723504-9723526 CCACTCCCACTCTGGGCCCTGGG + Intronic
950339167 3:12227069-12227091 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
950928954 3:16770365-16770387 CATCTCCCATTCGGTGGCCTTGG - Intergenic
950982741 3:17326496-17326518 CAGGTCTCACTCTGTTGCCCAGG + Intronic
950994649 3:17481527-17481549 CAGGTCTCGCTCTGTGGCCCAGG - Intronic
951737856 3:25887551-25887573 TAGCTCCCTCTCTGTGGGCTTGG + Intergenic
952644591 3:35639766-35639788 CCTCTCCCACTCTGTGCCCCTGG - Intronic
953137163 3:40190884-40190906 CAGATCCAACTGTGTGGCCTTGG + Intronic
953346549 3:42180651-42180673 CAGGTCTCACTCTATCGCCTAGG - Intronic
953897434 3:46812758-46812780 CAGCTGCCACTCTGAGGCGAGGG - Intergenic
954066014 3:48106811-48106833 AAGCTCTCACTTTGTCGCCTAGG + Intergenic
954146107 3:48635114-48635136 CAGCTGCCTCCCTGTGGCCCGGG + Intronic
954372181 3:50174726-50174748 CAGCTTCTACCATGTGGCCTGGG + Intronic
954581194 3:51703790-51703812 CAGCTGCCACACTGTCACCTGGG + Exonic
954611820 3:51948317-51948339 CAGCTCCAACTCAGTGTCCTGGG - Exonic
954705636 3:52479191-52479213 GAGCTGACACTCTGTGGCCTGGG - Intronic
954757341 3:52848457-52848479 CAGGTGCCACTCAGTGACCTGGG - Intronic
955551958 3:60094712-60094734 CAGCTACCACTCTGTTTGCTGGG - Intronic
956051016 3:65248650-65248672 CACCTCCCACTCTCTTGCTTGGG - Intergenic
956114101 3:65901294-65901316 GAGCTCCCAGTCTCTGGTCTGGG - Intronic
956520317 3:70096516-70096538 AAGGGCTCACTCTGTGGCCTAGG - Intergenic
956885120 3:73551489-73551511 GAGGTCTCACTGTGTGGCCTAGG - Intronic
956977843 3:74602268-74602290 CAGGTCTTGCTCTGTGGCCTGGG - Intergenic
958616727 3:96503187-96503209 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
959014961 3:101123328-101123350 CAGCTGCAAATCTGTGGCGTGGG + Intergenic
959364401 3:105438844-105438866 AAGATCTCACTCTGTGGCCCAGG - Intronic
959508154 3:107177820-107177842 CAGCTCCCCCTCTATGGCTCTGG + Intergenic
959863696 3:111242997-111243019 CAGTTCCCACTCTGGTCCCTGGG + Intronic
959917169 3:111828755-111828777 CAGATCTCACTCTGTCGCCCAGG - Intronic
960923046 3:122767825-122767847 CACCACCCACTCTCTGGACTTGG - Intronic
961034064 3:123629993-123630015 CTGCCCCCTCTCTGTGGACTGGG + Intronic
961234348 3:125351351-125351373 AAGGTCTCACTCTGTGGCCCAGG - Intronic
961583341 3:127901728-127901750 TGGGTCCCACTCTGTTGCCTGGG + Intergenic
962018157 3:131465920-131465942 AAGGTCCCACTCTGTTGCCCAGG + Intronic
962220694 3:133562427-133562449 CAGGTCTCACTCTGTGACCCAGG + Intergenic
962385761 3:134930937-134930959 CAGCTCCCTCTTTGTGTCCCTGG + Intronic
962433856 3:135346704-135346726 CAGTTCCCACTGTGAGGCCTGGG - Intergenic
963207622 3:142652564-142652586 CGCCTCCTACTCTGTGCCCTCGG - Intronic
963313561 3:143734169-143734191 CAGGTCTCACTCTGTTGCCCAGG - Intronic
964343645 3:155734265-155734287 CAGGTCTCACTATGTTGCCTGGG - Intronic
964792289 3:160463599-160463621 CAGCTCACATTCTCTGGGCTGGG - Intronic
965461246 3:168967175-168967197 AGGCTCTCACTCTGTGGCCCAGG + Intergenic
966222755 3:177566782-177566804 CACCTCCTGCTGTGTGGCCTGGG - Intergenic
966393141 3:179474161-179474183 AAGGTCTCACTCTGTCGCCTAGG - Intergenic
966774674 3:183533460-183533482 AAGGTCCCACTCTGTTGCCCAGG + Intronic
966955218 3:184869861-184869883 CAGGTCTCACTCTGTTGCCCAGG - Intronic
967021054 3:185523428-185523450 CAGGTCTCACTCTGTTGCCTAGG + Intronic
967159035 3:186718481-186718503 CAGATACCACTCTCTGGCCTGGG + Intronic
967163430 3:186759321-186759343 AGGGTCTCACTCTGTGGCCTAGG - Intergenic
967506287 3:190256297-190256319 CACCTCCCACTCTGTTGCTCAGG - Intergenic
967731436 3:192910450-192910472 CAGGTCTCACTCTGTTGCCCAGG - Intronic
967860944 3:194151159-194151181 CGGGTCTCACTCTGTTGCCTAGG - Intergenic
967862310 3:194161283-194161305 CTGCTCAGCCTCTGTGGCCTTGG + Intergenic
967866947 3:194198127-194198149 AAGCTCCTGCTGTGTGGCCTCGG + Intergenic
968227633 3:196985023-196985045 CAGGTACCACTCTGTGGCCCAGG - Intergenic
968438129 4:606018-606040 CACCTCCTGCTGTGTGGCCTGGG - Intergenic
968482912 4:844700-844722 CAGCCCCCACATTCTGGCCTTGG - Intergenic
968518943 4:1027152-1027174 CGGCGCCCTCTCTGTGTCCTGGG + Intergenic
968714929 4:2149758-2149780 CAGGTCTCACTCTGTTGCCCAGG - Intronic
968758805 4:2430879-2430901 AAGGTCTCACTGTGTGGCCTAGG - Intronic
968854168 4:3106328-3106350 CAGGTCTCACTCTGTTGCCCAGG - Intronic
969173397 4:5381719-5381741 TTGCTCCCACCCTGTGTCCTTGG + Intronic
969459659 4:7322242-7322264 CTGCTCCCACTCTCAGGCCTGGG - Intronic
969648816 4:8450821-8450843 AGGCTCTCACTCTGTCGCCTAGG + Intronic
969864600 4:10066210-10066232 TGGGTCCCACTCTGTTGCCTAGG - Intergenic
970630843 4:17942786-17942808 CTGGTACCAGTCTGTGGCCTAGG - Intronic
971260607 4:25053465-25053487 GAGCTCTCACTATGTTGCCTAGG + Intergenic
971411641 4:26379203-26379225 CAGGTCTCACTCTGTTGCCCAGG + Intronic
971457334 4:26857572-26857594 CGGCTCCCACTCTGTGGGCGGGG - Intergenic
971767149 4:30847095-30847117 AAGATCTCACTCTGTTGCCTAGG - Intronic
972023131 4:34340346-34340368 CAAGTCCCACTCTGTTGCCCAGG + Intergenic
972569888 4:40301034-40301056 CAAGTCTCACTCTGTTGCCTAGG + Intergenic
973616212 4:52680959-52680981 CAGATCTCACTCTGTTGCCCAGG - Intergenic
973912321 4:55593330-55593352 CAGATCTCACTCTGTCGCCCAGG - Intergenic
974413804 4:61577785-61577807 AAGCTCCCACTCTGTCACCTAGG - Intronic
975607714 4:76172290-76172312 CAGGTCTCACTCTGTTGCCCAGG + Intronic
975646462 4:76550805-76550827 CAGGTCTCACTATGTTGCCTAGG - Intronic
975820633 4:78267219-78267241 CACCTTCCTCTCTGTGTCCTAGG + Exonic
975924088 4:79427937-79427959 AAGATTTCACTCTGTGGCCTAGG + Intergenic
975995072 4:80303747-80303769 AAGCTCCCACACTGTGGAATGGG - Intronic
977252514 4:94704544-94704566 AAGCTCTCACTCTGTGGCCCAGG - Intergenic
977699935 4:100010058-100010080 AAGCTCTCACTCTGTTGCCCAGG + Intergenic
978213635 4:106170062-106170084 CTGGTACCAGTCTGTGGCCTGGG + Intronic
979576815 4:122302043-122302065 CAGGTCTCACTCTGTTGCCCAGG - Intronic
979642834 4:123029661-123029683 ATGGTCTCACTCTGTGGCCTAGG + Intronic
980058633 4:128104467-128104489 CCGCTCTCACTCTATGGCCCAGG + Intronic
980101593 4:128547037-128547059 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
980109522 4:128621905-128621927 CAGGTCTCACTATGTTGCCTAGG - Intergenic
980621376 4:135309028-135309050 CACCTCCCACACTGTTGCATTGG - Intergenic
981018791 4:140003745-140003767 CAGCTAGAACTCTGTGTCCTAGG + Intronic
981999966 4:151013473-151013495 GAGGTCTCACTCTGTTGCCTAGG - Intronic
982663845 4:158236709-158236731 AAGGTCTCACTCTGTCGCCTGGG + Intronic
982706050 4:158711249-158711271 AAGGTCTCACTCTGTGGCCCAGG + Intronic
982747312 4:159118072-159118094 CTGCTACCAGTCTGTGGCCCAGG - Intronic
982862610 4:160471792-160471814 GAAGTCCCACTCTGTGGCCCAGG - Intergenic
983208011 4:164931498-164931520 CAGGTCCCAGTCTGCGGCCAGGG + Intergenic
983252690 4:165362494-165362516 CAGATCTCACTCTGTTGCCCAGG - Intronic
983549843 4:169006307-169006329 GAGGTCACACTATGTGGCCTAGG - Intronic
983558298 4:169077518-169077540 AGGCTCCCACTATGTTGCCTAGG - Intergenic
984467519 4:180119391-180119413 GAGGTCTCACTCTGTTGCCTAGG - Intergenic
984726395 4:183025746-183025768 AAGCTCTCACTCTGTTGCCCAGG - Intergenic
985105068 4:186491780-186491802 CAGGTCTCACTCTGTCGCCCAGG - Intronic
985424778 4:189819533-189819555 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
985723484 5:1502784-1502806 GCGCTCCCACTCTGTTTCCTTGG + Intronic
986186490 5:5446041-5446063 CAGGTCTCACTCTGTTGCCTAGG + Intronic
986254532 5:6091188-6091210 CAGCTCTACCTTTGTGGCCTTGG + Intergenic
986735645 5:10665583-10665605 CACCTCCTGCTGTGTGGCCTTGG - Intergenic
987262190 5:16215036-16215058 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
987312284 5:16692392-16692414 CAAGTCTCACTCTGTTGCCTAGG - Intronic
987711260 5:21502561-21502583 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
987992993 5:25239442-25239464 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
988597350 5:32607123-32607145 CATCTGCGACCCTGTGGCCTAGG - Intergenic
988679484 5:33471073-33471095 GAGCCACCACACTGTGGCCTGGG - Intergenic
988748888 5:34175067-34175089 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
989743411 5:44798797-44798819 CTGCTACCAGTCTGTGGCCTGGG - Intergenic
989756929 5:44966389-44966411 CAGGTCTCATTCTGTTGCCTAGG - Intergenic
990306030 5:54494751-54494773 CAGCTCTCACTGTGTTGCCCAGG + Intergenic
990739567 5:58898344-58898366 CACCTACAGCTCTGTGGCCTTGG - Intergenic
991119368 5:62993869-62993891 CAGCTCCACCTCTGTGGCTTTGG + Intergenic
991665574 5:68996341-68996363 CACCTCCTGCTGTGTGGCCTGGG - Intergenic
991919725 5:71643359-71643381 AAGGTCTCACTCTGTTGCCTAGG - Intronic
991927879 5:71722836-71722858 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
991981572 5:72236943-72236965 CAGGTCTCATTCTGTTGCCTAGG + Intronic
992289318 5:75268732-75268754 AAGATCTCACTCTGTCGCCTGGG - Intergenic
993240121 5:85371716-85371738 CAGATCTCACTCTGTTGCCTAGG - Intergenic
993566427 5:89481517-89481539 CAGGTCTCATTCTGTTGCCTTGG - Intergenic
993976403 5:94487925-94487947 AGGGTCCCACTCTGTGGCCCAGG - Intronic
994010514 5:94897080-94897102 CAGGTCTTACTCTGTTGCCTAGG + Intronic
994891979 5:105647781-105647803 CAGTTCCTACTCAGTGGCCCAGG + Intergenic
995518018 5:112973548-112973570 AAGATCCCACTCTGTTGCCCAGG - Intergenic
996043133 5:118839378-118839400 CAGGTCTCACTCTGTAGCCCAGG + Intronic
996067434 5:119094888-119094910 AAGGTCTCACTCTGTTGCCTGGG + Intronic
996455239 5:123674271-123674293 CAGATCTCACTCTGTCGCCCAGG + Intergenic
996523135 5:124449344-124449366 CAGCTGCAACTGTGAGGCCTTGG - Intergenic
996798942 5:127380851-127380873 CAGCTACCAGTCTATGGCCAGGG - Intronic
997030633 5:130123590-130123612 CACCTTCCAGTCTGTGGCCTGGG + Intronic
997540383 5:134656805-134656827 CAGCTCTCATTCTGTCGCCCTGG + Intronic
998010603 5:138692537-138692559 CAGGTCTCACTCTGTGACCCAGG + Intronic
998016408 5:138735629-138735651 CAGCTCCAACTCTGTGGGTCAGG - Intronic
998041117 5:138951576-138951598 CAGCTCCTGTGCTGTGGCCTTGG - Intronic
998837550 5:146217498-146217520 AAGGTCTCACTCTGTTGCCTAGG + Intronic
998839236 5:146235703-146235725 AAGATCTCACTCTGTGCCCTAGG + Intronic
999103865 5:149051643-149051665 CAGGTCTCACTCTGTTGCCCAGG + Intronic
999182233 5:149677880-149677902 AAGCGACCTCTCTGTGGCCTGGG + Intergenic
999195891 5:149781357-149781379 TAGCTGCCATTCTGTGACCTGGG + Intronic
1001042793 5:168348797-168348819 CAGCCCCCACACTGCAGCCTGGG + Intronic
1001093934 5:168761762-168761784 CGGGTCTCACTCTGTGGCCCAGG + Intronic
1001556962 5:172643109-172643131 CAACTCTCTCTCTGTGGACTGGG + Intronic
1001694616 5:173660766-173660788 CTGCTCTCTCACTGTGGCCTGGG - Intergenic
1001941684 5:175744219-175744241 CAGGTCTCACTCTGTCGCATAGG + Intergenic
1002019312 5:176352354-176352376 CAGCTCTGTCACTGTGGCCTTGG - Intronic
1002026559 5:176399850-176399872 CAAGTCTCACTCTGTGGCCCAGG - Intronic
1002044357 5:176533608-176533630 CACCTCCCACTTTGAGGGCTGGG - Intronic
1002069941 5:176673232-176673254 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1002089725 5:176797466-176797488 CAGCTCACACCCTGTGGCCTCGG + Intergenic
1002213633 5:177612664-177612686 CCTCTCTCACTCTGTGGCCAAGG + Intergenic
1002525527 5:179813727-179813749 AAGGTCTCACTCTGTGGCCCAGG - Intronic
1002606189 5:180384353-180384375 CAGGTCTCGCTCTGTGGCCCAGG - Intergenic
1002694360 5:181074469-181074491 AAGGTCTCACTTTGTGGCCTAGG - Intergenic
1002918323 6:1547028-1547050 CAAGTCTCACTCTGTGGCCCAGG + Intergenic
1002991066 6:2239303-2239325 CAGATCTTACTCTGTTGCCTAGG - Intronic
1003399585 6:5780961-5780983 CAGCTCCCAGCCTGGGGCCTTGG + Intergenic
1003589926 6:7428468-7428490 CAGATCTCACTCTGTCGCCCAGG - Intergenic
1003663251 6:8085170-8085192 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1003735815 6:8876574-8876596 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1003757458 6:9137655-9137677 CAGATGCCACTCTTTGACCTTGG + Intergenic
1004099006 6:12589628-12589650 AAGATCTCACTCTGTGGCCCAGG + Intergenic
1005113986 6:22316331-22316353 CAGGTCTCACTCTGTGGCCCAGG + Intergenic
1005120126 6:22380226-22380248 CATCGCCCCCACTGTGGCCTCGG - Intergenic
1005728961 6:28677051-28677073 CCGGTCTCACTCTGTGGCCCAGG - Intergenic
1005980524 6:30833170-30833192 AAGATCTCACTCTGTTGCCTAGG + Intergenic
1006020877 6:31116870-31116892 CAGCTCCCACTCTGTGTCAGGGG - Exonic
1006023492 6:31132202-31132224 CAGTTCTCACTCTGTTGCCCAGG - Intronic
1006053565 6:31363161-31363183 AAGATCCCACTCTGTGGTCTGGG - Intergenic
1006085065 6:31589553-31589575 CAGCTTTCTCTCTGTGGCCGTGG - Exonic
1006086055 6:31596085-31596107 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
1006166200 6:32067048-32067070 AAGGTCTCACTCTGTCGCCTGGG - Intronic
1006476077 6:34255073-34255095 CAGTTCCCCCTATGTTGCCTAGG + Intergenic
1006478951 6:34276361-34276383 CAGGTCTCCCTCTGTGTCCTAGG + Intergenic
1006486110 6:34343513-34343535 GGGGTCTCACTCTGTGGCCTAGG - Intronic
1006912528 6:37572659-37572681 AGGGTCTCACTCTGTGGCCTAGG + Intergenic
1007097572 6:39223308-39223330 CAGCTGCCACTGCGGGGCCTTGG - Intronic
1007529263 6:42526495-42526517 GAGGTCTCACTCTGTAGCCTAGG - Intergenic
1007766961 6:44166347-44166369 CAACCCTCACTCTGTGACCTCGG + Intronic
1007796686 6:44354306-44354328 AAGTTCTCACTCTGTCGCCTAGG - Intronic
1007825772 6:44599595-44599617 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1007931138 6:45691600-45691622 AACCTCACACTCTGTGCCCTGGG + Intergenic
1007992831 6:46275116-46275138 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1008517543 6:52332485-52332507 CAGGTCTCGCTCTGTGGCCCAGG + Intergenic
1008641117 6:53463710-53463732 CAACTCTCACTCTGTTGCCCAGG + Intergenic
1009017189 6:57919027-57919049 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1009630211 6:66188550-66188572 CAACTACCAGTCTGTGGCCTGGG + Intergenic
1009962083 6:70535364-70535386 CAGGTACCAGTCTGTGGCCCAGG - Intronic
1010868027 6:81004654-81004676 CGGCTCCCACTCTCTCTCCTGGG + Intergenic
1011216335 6:85009737-85009759 CAGGTACCAGTCTGTGGCCCGGG + Intergenic
1011261380 6:85473464-85473486 TAGCTCCCACTGTGTGTCCAAGG - Intronic
1011489147 6:87872716-87872738 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
1011784267 6:90826583-90826605 CAGCTCCACCTCTGCGGCTTTGG - Intergenic
1012897318 6:104965545-104965567 CTGGTCTCACTCTGTTGCCTAGG + Intronic
1012915249 6:105162953-105162975 CAGTGACCACTGTGTGGCCTGGG - Intronic
1013124663 6:107171185-107171207 CAGGTCTCACTCTGTCACCTAGG + Intronic
1013210773 6:107984717-107984739 CAGTTCTCACTCTGTTGCCCAGG - Intergenic
1013375794 6:109512887-109512909 AGGCTCTCACTCTGTTGCCTAGG + Intronic
1013486710 6:110603665-110603687 AAGCTCTCACTCTGTTGCCCAGG - Intergenic
1013679376 6:112507068-112507090 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1013782214 6:113741432-113741454 AAGCTCTCACTCTGTTGCCCAGG + Intergenic
1014719413 6:124898052-124898074 AAGCTCTCACTCTGTTGCCCAGG + Intergenic
1015019925 6:128460517-128460539 CAGGTCTCACTTTGTTGCCTAGG - Intronic
1015111875 6:129601651-129601673 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1015155480 6:130090619-130090641 AAGGTCTCACTCTGTCGCCTAGG + Intronic
1015182358 6:130374212-130374234 CAGCCCCGCCTCTGTAGCCTTGG + Intronic
1015950334 6:138546581-138546603 AAGGTCTCACTCTGTTGCCTGGG - Intronic
1016039662 6:139419817-139419839 CAGCTTTCACTCTGTTGCCCAGG + Intergenic
1016225728 6:141734090-141734112 CAGGTCTCACTCTGTTGCCTAGG - Intergenic
1017064632 6:150517904-150517926 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1017216285 6:151911130-151911152 CTGGTACCAGTCTGTGGCCTGGG + Intronic
1017477648 6:154814290-154814312 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1017520977 6:155202442-155202464 AAGGTCTCACTCTGTCGCCTAGG + Intronic
1018050062 6:160001079-160001101 CCGCTACCAGTCTGTGGCCCGGG - Intronic
1018990038 6:168667590-168667612 CAGCTGCCACCCTCAGGCCTGGG + Exonic
1019263971 7:101979-102001 CAGGCCCCACTCTGTGGCTTTGG - Intergenic
1019495022 7:1333751-1333773 CAGGTCTCACTCTGTCGCCCAGG - Intergenic
1019946439 7:4333264-4333286 AGGCTCTCACTCTGTGGCCCAGG + Intergenic
1020047803 7:5056131-5056153 AAGGTCTCACTCTGTTGCCTAGG + Intronic
1020075868 7:5258473-5258495 CAGTTCTCACTCTGTTGCCCAGG - Intergenic
1020198893 7:6063818-6063840 CAGATCTCCCTCTGTGGCCCAGG - Intergenic
1020301055 7:6795904-6795926 AAGCTCTCACTCTATGGCCCAGG - Intronic
1022620945 7:31984123-31984145 CTGCTACCAGTCTGTGGCCTTGG - Intronic
1022665892 7:32410303-32410325 CGGGTCTCACTCTGTGGCCCAGG - Intergenic
1022687864 7:32613455-32613477 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
1022791733 7:33695781-33695803 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1022978894 7:35584446-35584468 AGGGTCCCACTCTGTGGCCCAGG - Intergenic
1023182653 7:37501040-37501062 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1023351128 7:39321028-39321050 AAGGGCTCACTCTGTGGCCTAGG - Intronic
1023688346 7:42760262-42760284 CAGCTCCCACTCTTAGGACATGG - Intergenic
1023750260 7:43365326-43365348 CCCCACCCACTCTGAGGCCTGGG + Intronic
1023823352 7:43992345-43992367 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1024467937 7:49732923-49732945 CAGAACCCAGGCTGTGGCCTTGG + Intergenic
1025203215 7:56975089-56975111 CAGTTCTCACTCTGTTGCCCAGG + Intergenic
1025668729 7:63601838-63601860 CAGTTCTCACTCTGTTGCCCAGG - Intergenic
1025972844 7:66344202-66344224 CAGATCTCTCTCTGTTGCCTAGG - Intronic
1026354900 7:69549015-69549037 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1026495312 7:70896748-70896770 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
1026574328 7:71559668-71559690 AAGGTCCCACTCTGTTGCCCAGG - Intronic
1026623603 7:71973199-71973221 CAGTTCTCACTCTGTTGCCCTGG + Intronic
1026795785 7:73365195-73365217 GAGGTCTCACTCTGTGGCCCAGG - Intergenic
1026795791 7:73365277-73365299 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1026805567 7:73427647-73427669 CAAGTCTCACTCTGTTGCCTAGG - Intergenic
1026901468 7:74039715-74039737 GAGCACCCACTGTGTGCCCTGGG + Intronic
1027410601 7:77913638-77913660 CAGCTCTCACTATGTTGCCAAGG + Intronic
1027889412 7:83951245-83951267 CTGGTACCACACTGTGGCCTGGG + Intergenic
1028466473 7:91158236-91158258 AAGCTCCCATTCTGCAGCCTAGG + Intronic
1029592142 7:101514436-101514458 CAGCTGCCTCTCTGGGCCCTGGG + Intronic
1029594823 7:101531938-101531960 TAGCTCCCACTCTGCGTGCTGGG - Intronic
1029623514 7:101705169-101705191 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1029692037 7:102188947-102188969 CTGCTCCCTCTCAGGGGCCTAGG - Intronic
1030161333 7:106511312-106511334 CGGCTCCTACTCTGTGGCCCCGG - Intergenic
1030361035 7:108595743-108595765 TTGCTCCCAGCCTGTGGCCTCGG - Intergenic
1030570120 7:111212583-111212605 AGGGTCCCACTCTGTTGCCTAGG - Intronic
1031786956 7:126045301-126045323 CAGGTCCCAGTTTGTGGCCCCGG - Intergenic
1032059578 7:128713279-128713301 AAGGTCTCACTCTGTGGCCCAGG - Intronic
1032062471 7:128736572-128736594 CTGCTCTCACTCGATGGCCTCGG + Intergenic
1032093438 7:128923575-128923597 CAGCTGCCATTCCATGGCCTCGG - Intergenic
1032160567 7:129506414-129506436 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1032800071 7:135310667-135310689 CAGCTCCCAACCTATGGCCAAGG - Intergenic
1033081055 7:138297737-138297759 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
1033140834 7:138824957-138824979 CAGGTCCCACTATGTTGCCCAGG + Intronic
1033480742 7:141738005-141738027 CAGGTCTCACTATGTCGCCTAGG + Intergenic
1034250756 7:149688717-149688739 CACCTCCCACACTGTTGCATTGG + Intergenic
1034422656 7:150997490-150997512 CAGCCCCGAGTCTGTGGGCTGGG - Intronic
1034528679 7:151682264-151682286 AAGGTCTCACTCTGTGGCCCAGG + Intronic
1034682264 7:152938092-152938114 CAGCTCCCACATGATGGCCTGGG + Intergenic
1035261492 7:157664377-157664399 GAGCCCCCGCTCTGTGCCCTGGG - Intronic
1035382480 7:158448614-158448636 CAGCTCCCACTCCTGGGCCAAGG + Intronic
1035439861 7:158888048-158888070 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1035539422 8:421057-421079 CACCTCCTGCTCTGTGGCCCAGG - Intronic
1035861980 8:3039062-3039084 TTGCTCCCACTCTGCTGCCTGGG - Intronic
1036412934 8:8519391-8519413 CAGGTCTCACTCTGTTGCTTAGG + Intergenic
1036626753 8:10478961-10478983 CAGCTCCCAGCCTGTGGCAGAGG + Intergenic
1036798862 8:11774910-11774932 CAGCTCTGCCTCTGTGGCTTTGG + Intronic
1037516234 8:19634634-19634656 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1037537633 8:19840035-19840057 AAGGTCTCACTCTGTCGCCTAGG - Intronic
1037589919 8:20303869-20303891 CGGCTCCCACTCACTGGCCGAGG + Exonic
1037742476 8:21618532-21618554 CAGGTACCAGTCTGTGGCCTGGG - Intergenic
1037771163 8:21800898-21800920 CAGGTCTCACTCTGTGACCCAGG - Intronic
1038044709 8:23756391-23756413 GGGGTCTCACTCTGTGGCCTAGG - Intergenic
1038519720 8:28220041-28220063 CAGGTCTCGCTCTGTGGCCCAGG - Intergenic
1038636259 8:29289831-29289853 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1039000021 8:32969321-32969343 TAGGTCTCACTCTGTTGCCTAGG - Intergenic
1039080578 8:33730171-33730193 AAGGTCTCACTCTGTGGCCCAGG - Intergenic
1039528823 8:38241043-38241065 GAGGTCTCACTCTGTTGCCTAGG - Intronic
1039537267 8:38328157-38328179 GAGGTCTCACTCTGTGGCCCAGG - Intronic
1039544584 8:38399918-38399940 CAAGTCCCACTCTGTTGCCCAGG - Intronic
1040006769 8:42627757-42627779 CAGCTCACATTCTGGTGCCTTGG + Intergenic
1040054203 8:43043352-43043374 CAACTGCCACTCTGGTGCCTTGG + Intronic
1040350453 8:46561561-46561583 CAGCTCCCACTTTGTAGAATAGG - Intergenic
1040408185 8:47129761-47129783 CTGGTACCAGTCTGTGGCCTGGG - Intergenic
1040572229 8:48621233-48621255 CAGCCCCCTCTCTGAGGCCGAGG - Intergenic
1040837385 8:51746745-51746767 AAACTCTCACTCTGTGGCCCAGG + Intronic
1041085525 8:54253053-54253075 GAGGTCTCACTCTGTTGCCTGGG - Intergenic
1041712459 8:60906904-60906926 AAATTCCCAGTCTGTGGCCTGGG + Intergenic
1042033372 8:64502047-64502069 GAGGTCTCACTCTGTTGCCTAGG - Intergenic
1042197649 8:66246254-66246276 CACCTCCCACACTGTTGCATTGG + Intergenic
1042219118 8:66455907-66455929 AGGGTCCCACTCTGTTGCCTGGG - Intronic
1042444188 8:68864319-68864341 CAGGTCTCACTGTGTTGCCTAGG - Intergenic
1042444870 8:68872107-68872129 GAGCTCTCACTGTGTTGCCTAGG + Intergenic
1042548273 8:69970653-69970675 AAGGTCTCACTCTGTTGCCTAGG + Intergenic
1042875738 8:73438595-73438617 CAGCTTCCACTCCCTGGGCTTGG - Intronic
1042989487 8:74622576-74622598 AGGGTCTCACTCTGTGGCCTAGG - Intronic
1043080659 8:75761087-75761109 CAGCTCCATCCCTGTGGCTTTGG - Intergenic
1043258557 8:78167694-78167716 CAGGTCTCACTCTGTTGCCTAGG + Intergenic
1043431493 8:80199462-80199484 CAGGTCTCACTCTGTCGCCCAGG + Intronic
1043524402 8:81080877-81080899 CAGCTATGACTCTGTGACCTAGG + Intronic
1043953413 8:86335567-86335589 CAGCTCCCACCTTGCTGCCTTGG - Intergenic
1043966008 8:86476719-86476741 CAAGTCTCACTCTGTGGCCCAGG + Intronic
1043966078 8:86477910-86477932 CAGGTCTCACTCTGTTGCCCAGG + Intronic
1044120377 8:88387152-88387174 AAGGTCTCACTCTGTCGCCTAGG + Intergenic
1044392275 8:91665232-91665254 CAGGTCTCACTCTGTTGCTTAGG - Intergenic
1044586785 8:93875873-93875895 CACCTCCTGCTGTGTGGCCTGGG + Intronic
1045075726 8:98565156-98565178 CAGATTCCAATGTGTGGCCTGGG - Intronic
1045109610 8:98927804-98927826 CAGCTCCCACTCTGTGGCCTAGG - Intronic
1045815342 8:106270999-106271021 CAGTTCCCAACATGTGGCCTCGG - Intronic
1045906903 8:107356592-107356614 AAGCTCTAACTCTGTTGCCTAGG - Intronic
1045945297 8:107788796-107788818 CAGATCCCAGTCTTTGTCCTGGG - Intergenic
1046244204 8:111537719-111537741 CAGCTCTCCCTCTGTTGCCCAGG - Intergenic
1046288296 8:112125106-112125128 CAGCGCTCACTCTGTTGCCCAGG - Intergenic
1046416588 8:113922931-113922953 GAGGTCTCACTCTGTTGCCTAGG - Intergenic
1046480495 8:114810928-114810950 CAGCTCTCGCTCTGTTGCCCAGG + Intergenic
1046618581 8:116503370-116503392 GAGATCTCACTCTGTTGCCTAGG - Intergenic
1047205697 8:122801724-122801746 GAGGTCTCACTCTGTGGCCTGGG - Intronic
1047207241 8:122812468-122812490 TTTTTCCCACTCTGTGGCCTTGG - Intronic
1047949945 8:129924246-129924268 CAGGTCTCACTCTGTCGCTTGGG - Intronic
1048320642 8:133397200-133397222 CAGGTCTCACTCTGTTGCCCAGG - Intergenic
1048736179 8:137504639-137504661 CAGATCTCACTCTGTCGCCCAGG + Intergenic
1049255794 8:141613089-141613111 CAGCTCCATGCCTGTGGCCTTGG + Intergenic
1049423549 8:142527215-142527237 CAGCTTCCCCTCTGTGCCCAGGG - Intronic
1049626987 8:143628615-143628637 AAGGTCTCACTCTGTGGCCCAGG + Intergenic
1049662031 8:143823796-143823818 CTGCACCCACTCTGGAGCCTGGG + Intronic
1050171855 9:2828063-2828085 AAGGTCTCACTCTGTTGCCTAGG + Intronic
1051758915 9:20438624-20438646 CAGGTCTCACTCTGTGGCCCAGG + Intronic
1051942887 9:22530199-22530221 AAGCTCCCAATATGCGGCCTGGG + Intergenic
1052713496 9:32087308-32087330 CAGCAGCCATTCTGTGGCCCTGG - Intergenic
1053136516 9:35653943-35653965 AAGCTCTCACTCTGTTGCCCAGG - Intergenic
1053473845 9:38367370-38367392 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1054710041 9:68502157-68502179 CTGATCCCACTCTGTGTCCTTGG + Intronic
1054817235 9:69486821-69486843 CAGCTCCTACTCTCTGCCCCGGG + Intronic
1055140950 9:72876340-72876362 CAGAGCCCACACTGTTGCCTGGG - Intergenic
1055152924 9:73024714-73024736 AGAGTCCCACTCTGTGGCCTAGG - Intronic
1055469641 9:76598418-76598440 CAAGTCCCACTCTGTCGCCCAGG - Intergenic
1056150438 9:83782168-83782190 AAGATCTCACTCTGTTGCCTAGG + Intronic
1056370898 9:85953185-85953207 CAGGTCTCACTCTGTTGCCCAGG - Intronic
1056776380 9:89516105-89516127 GGGCTCCCACTCTTTGTCCTGGG + Intergenic
1056828923 9:89898597-89898619 CAGGTCTCACTTTGTTGCCTTGG + Intergenic
1056846112 9:90039640-90039662 CAGCTCCCAGCCTCTTGCCTGGG + Intergenic
1056903945 9:90628569-90628591 AAGGTCTCACTCTGTTGCCTAGG + Intronic
1057165519 9:92922096-92922118 CAGGTCTCACTATGTTGCCTGGG + Intergenic
1057310364 9:93939164-93939186 CAGCTCCTTCCCTGGGGCCTTGG + Intergenic
1057470816 9:95354476-95354498 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1057551454 9:96053827-96053849 CAGCTCACCTGCTGTGGCCTGGG - Intergenic
1057753835 9:97813976-97813998 CAGGTCTTACTCTGTGGCCTAGG - Intergenic
1057779754 9:98040033-98040055 CAGGTCTCACTATGTTGCCTAGG + Intergenic
1057792784 9:98135074-98135096 CACCTCCCACTCAGTGGCTATGG + Intronic
1058357944 9:104105857-104105879 CACCTCCCAAGCTGTGGCCATGG - Intronic
1058617322 9:106845337-106845359 AGGCTCTCACTCTGTTGCCTAGG + Intergenic
1058673822 9:107383498-107383520 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1059075655 9:111191136-111191158 AAGTTCTCACTCTGTGGCCCAGG - Intergenic
1059173803 9:112151134-112151156 CAGCTCTCACTATGTTGCCCAGG + Intronic
1059242154 9:112815866-112815888 AAGGTCTCACTCTGTCGCCTAGG + Intronic
1060289196 9:122284809-122284831 AAGATCTCACTCTGTTGCCTAGG + Intronic
1060397060 9:123323652-123323674 TAGGTCTCACTCTGTCGCCTAGG - Intergenic
1060642269 9:125249052-125249074 CAGATCTCACTCTGTTGCCCAGG + Intergenic
1060842067 9:126801620-126801642 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1060954684 9:127630009-127630031 CAGCCCCCACTCTCTAGGCTGGG + Intronic
1061027272 9:128057901-128057923 AAGTTCTCACTCTGTTGCCTAGG - Intergenic
1061138624 9:128751097-128751119 CAGCTCCAAGCCTGGGGCCTTGG - Intronic
1061185119 9:129048518-129048540 CTCCTCCCACAGTGTGGCCTCGG + Exonic
1061217485 9:129230166-129230188 CAGGCCCCACACTGGGGCCTGGG - Intergenic
1061499651 9:130994494-130994516 CAGCCCACACTCTGGGCCCTGGG - Intergenic
1062426560 9:136508767-136508789 CAGGTCCCACTGTGTCGGCTCGG - Intronic
1062561409 9:137143761-137143783 CTGCTCCCTCTTTGTGGCCTGGG - Intronic
1062641852 9:137522876-137522898 CAGTCCCCACTCTGTGGGCCTGG + Intronic
1203733409 Un_GL000216v2:112321-112343 CAGGTCTCACTATGTTGCCTGGG + Intergenic
1185811168 X:3112059-3112081 CAGGTACCAGTTTGTGGCCTGGG + Intronic
1185916170 X:4037849-4037871 CAGGTCTCACTCTGTTGCCCAGG + Intergenic
1186119994 X:6350494-6350516 TAGGTCTCACTCTGTTGCCTAGG + Intergenic
1186203261 X:7175466-7175488 CAGGTCTCACTCTGTCTCCTAGG - Intergenic
1186414651 X:9372631-9372653 CAGGTCTCACTCTGTCACCTAGG - Intergenic
1186506068 X:10093298-10093320 CAGGTCTCACTATGTTGCCTGGG - Intronic
1186552533 X:10521863-10521885 AAGGTCTCACTCTGTCGCCTAGG + Intronic
1186932608 X:14411383-14411405 CAGCTTCCTCTCAGTGACCTTGG - Intergenic
1187240395 X:17507841-17507863 CATCTCTCACACTGTGGCTTTGG + Intronic
1187601679 X:20838832-20838854 CAGCTCACACTCTCTTGACTGGG + Intergenic
1188378027 X:29456939-29456961 AAGCTCCCACTATGTTGCCCAGG - Intronic
1188739146 X:33755843-33755865 GAAGTCTCACTCTGTGGCCTAGG + Intergenic
1188889749 X:35595410-35595432 CAGCTCCACCCCTGTGGCTTTGG - Intergenic
1190784709 X:53634364-53634386 AAGGTCTCACTCTGTTGCCTAGG - Intronic
1190787513 X:53665961-53665983 GAGGTCTCACTCTGTGGCCCAGG - Intronic
1190882618 X:54503359-54503381 CAGGTCTCACTATGTTGCCTAGG - Intergenic
1192219550 X:69188133-69188155 CAGCTCCCAGGCTGAGGTCTGGG - Intergenic
1192346440 X:70311926-70311948 ACGGTCCCACTCTATGGCCTAGG - Intronic
1192459935 X:71308319-71308341 AAGGTCTCACTCTGTTGCCTAGG - Intergenic
1192545108 X:72006576-72006598 CAGCTCTCGCTCTGTTGCCCAGG + Intergenic
1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG + Intergenic
1195423326 X:104699558-104699580 CACCTCCTACTGTGTGGCTTAGG + Intronic
1195921586 X:109989167-109989189 AAGGTCTCACTCTGTGACCTGGG - Intergenic
1196402312 X:115329517-115329539 CAGATACCGGTCTGTGGCCTGGG + Intergenic
1196750168 X:119108816-119108838 CAGGTCTCACTCTGTCACCTAGG - Intronic
1196928879 X:120661380-120661402 AAGGTCTCACTCTGTTGCCTTGG - Intergenic
1197197749 X:123720118-123720140 AAGGTCTCACTCTGTTGCCTAGG - Intronic
1198149716 X:133896333-133896355 AATCTCTCACTCTGTTGCCTAGG - Intronic
1198395667 X:136216572-136216594 AAGGTCTCACTCTGTGGCCAAGG - Intronic
1199643118 X:149882155-149882177 CTGCTCCCACTCTCAGGTCTGGG + Intronic
1199735279 X:150680315-150680337 CAAATCCCCCTCTGTGTCCTTGG - Intergenic
1199753106 X:150839841-150839863 GAGGTCTCACTATGTGGCCTTGG - Intronic
1199757771 X:150881226-150881248 GAAATCCCACTCTGTGGCCTTGG + Intronic
1200009941 X:153113273-153113295 AAGCTCTCACTCTGTTGCCCAGG - Intergenic
1200029659 X:153286649-153286671 AAGCTCTCACTCTGTTGCCCAGG + Intergenic
1200119323 X:153783065-153783087 CTGTTGCCACTCCGTGGCCTCGG - Exonic
1200225653 X:154415853-154415875 CAGGTCTCCCTCTGTGGCCCAGG - Intronic
1200766027 Y:7081430-7081452 CAGATCTCACTCTGTTGCCTAGG - Intronic
1200919042 Y:8596735-8596757 CTGCTCACACTCTGTGTCCCAGG - Intergenic
1200926947 Y:8663219-8663241 CTGCTCACACTCTATGCCCTAGG - Intergenic
1201368617 Y:13235803-13235825 AAGGTCCCACTCTGTTGCCTAGG + Intergenic
1202150382 Y:21838744-21838766 CTGCTCACACTCTGTGTCCCAGG + Intergenic
1202627599 Y:56876095-56876117 CAGGTCTCACTATGTTGCCTGGG - Intergenic