ID: 1045112176

View in Genome Browser
Species Human (GRCh38)
Location 8:98946661-98946683
Sequence TTGTGGCAGTGTAACCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045112173_1045112176 14 Left 1045112173 8:98946624-98946646 CCATTCAGAGAAAAGGGAAAGAA 0: 1
1: 0
2: 8
3: 76
4: 721
Right 1045112176 8:98946661-98946683 TTGTGGCAGTGTAACCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045112176 Original CRISPR TTGTGGCAGTGTAACCTTTA TGG Intronic
No off target data available for this crispr