ID: 1045114922

View in Genome Browser
Species Human (GRCh38)
Location 8:98972323-98972345
Sequence CTGCTCCTCTAGGGCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045114909_1045114922 29 Left 1045114909 8:98972271-98972293 CCAAAGGACCTCAGGCTCTCGGA No data
Right 1045114922 8:98972323-98972345 CTGCTCCTCTAGGGCTTGGAGGG No data
1045114916_1045114922 -3 Left 1045114916 8:98972303-98972325 CCTCGGGCTGCACGGAACCACTG No data
Right 1045114922 8:98972323-98972345 CTGCTCCTCTAGGGCTTGGAGGG No data
1045114911_1045114922 21 Left 1045114911 8:98972279-98972301 CCTCAGGCTCTCGGACACCAGGA No data
Right 1045114922 8:98972323-98972345 CTGCTCCTCTAGGGCTTGGAGGG No data
1045114915_1045114922 4 Left 1045114915 8:98972296-98972318 CCAGGAGCCTCGGGCTGCACGGA No data
Right 1045114922 8:98972323-98972345 CTGCTCCTCTAGGGCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045114922 Original CRISPR CTGCTCCTCTAGGGCTTGGA GGG Intergenic
No off target data available for this crispr