ID: 1045114964

View in Genome Browser
Species Human (GRCh38)
Location 8:98972501-98972523
Sequence TGGGGCTCGGGCGGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045114953_1045114964 5 Left 1045114953 8:98972473-98972495 CCGGCTCATGGCTTAGGGGCCAC No data
Right 1045114964 8:98972501-98972523 TGGGGCTCGGGCGGGGCTCTGGG No data
1045114947_1045114964 20 Left 1045114947 8:98972458-98972480 CCTCACTTTCCGGCGCCGGCTCA No data
Right 1045114964 8:98972501-98972523 TGGGGCTCGGGCGGGGCTCTGGG No data
1045114949_1045114964 11 Left 1045114949 8:98972467-98972489 CCGGCGCCGGCTCATGGCTTAGG No data
Right 1045114964 8:98972501-98972523 TGGGGCTCGGGCGGGGCTCTGGG No data
1045114945_1045114964 29 Left 1045114945 8:98972449-98972471 CCGCGCTTGCCTCACTTTCCGGC No data
Right 1045114964 8:98972501-98972523 TGGGGCTCGGGCGGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045114964 Original CRISPR TGGGGCTCGGGCGGGGCTCT GGG Intergenic