ID: 1045116183

View in Genome Browser
Species Human (GRCh38)
Location 8:98983293-98983315
Sequence CTGGCTATTCAACCTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045116181_1045116183 -3 Left 1045116181 8:98983273-98983295 CCTCTAAAAGTGCGGTATGACTG No data
Right 1045116183 8:98983293-98983315 CTGGCTATTCAACCTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045116183 Original CRISPR CTGGCTATTCAACCTTTTGT TGG Intergenic
No off target data available for this crispr