ID: 1045116380

View in Genome Browser
Species Human (GRCh38)
Location 8:98986906-98986928
Sequence TTTCACTTGGTGAAGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045116372_1045116380 26 Left 1045116372 8:98986857-98986879 CCTTTCCCAAAATGTTAGCAGAG No data
Right 1045116380 8:98986906-98986928 TTTCACTTGGTGAAGGAGTCAGG No data
1045116375_1045116380 21 Left 1045116375 8:98986862-98986884 CCCAAAATGTTAGCAGAGGGACA No data
Right 1045116380 8:98986906-98986928 TTTCACTTGGTGAAGGAGTCAGG No data
1045116376_1045116380 20 Left 1045116376 8:98986863-98986885 CCAAAATGTTAGCAGAGGGACAG No data
Right 1045116380 8:98986906-98986928 TTTCACTTGGTGAAGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045116380 Original CRISPR TTTCACTTGGTGAAGGAGTC AGG Intergenic
No off target data available for this crispr