ID: 1045117447

View in Genome Browser
Species Human (GRCh38)
Location 8:98999011-98999033
Sequence GAAAATGCTCACAGGCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045117441_1045117447 -7 Left 1045117441 8:98998995-98999017 CCATCCTACAACCCAAGAAAATG No data
Right 1045117447 8:98999011-98999033 GAAAATGCTCACAGGCACCTGGG No data
1045117440_1045117447 -6 Left 1045117440 8:98998994-98999016 CCCATCCTACAACCCAAGAAAAT No data
Right 1045117447 8:98999011-98999033 GAAAATGCTCACAGGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045117447 Original CRISPR GAAAATGCTCACAGGCACCT GGG Intergenic
No off target data available for this crispr