ID: 1045117447 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:98999011-98999033 |
| Sequence | GAAAATGCTCACAGGCACCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045117441_1045117447 | -7 | Left | 1045117441 | 8:98998995-98999017 | CCATCCTACAACCCAAGAAAATG | No data | ||
| Right | 1045117447 | 8:98999011-98999033 | GAAAATGCTCACAGGCACCTGGG | No data | ||||
| 1045117440_1045117447 | -6 | Left | 1045117440 | 8:98998994-98999016 | CCCATCCTACAACCCAAGAAAAT | No data | ||
| Right | 1045117447 | 8:98999011-98999033 | GAAAATGCTCACAGGCACCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045117447 | Original CRISPR | GAAAATGCTCACAGGCACCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||