ID: 1045118739

View in Genome Browser
Species Human (GRCh38)
Location 8:99012967-99012989
Sequence GGGAACCGCCGCCGGCGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045118734_1045118739 -3 Left 1045118734 8:99012947-99012969 CCAAGACGGACCTCCACATCGGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
1045118725_1045118739 21 Left 1045118725 8:99012923-99012945 CCAGCGACCTGGGTGCCTCCCCA 0: 1
1: 0
2: 1
3: 22
4: 199
Right 1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
1045118732_1045118739 -2 Left 1045118732 8:99012946-99012968 CCCAAGACGGACCTCCACATCGG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
1045118726_1045118739 14 Left 1045118726 8:99012930-99012952 CCTGGGTGCCTCCCCACCCAAGA 0: 1
1: 1
2: 0
3: 18
4: 240
Right 1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
1045118731_1045118739 1 Left 1045118731 8:99012943-99012965 CCACCCAAGACGGACCTCCACAT 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
1045118729_1045118739 3 Left 1045118729 8:99012941-99012963 CCCCACCCAAGACGGACCTCCAC 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
1045118728_1045118739 6 Left 1045118728 8:99012938-99012960 CCTCCCCACCCAAGACGGACCTC 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
1045118730_1045118739 2 Left 1045118730 8:99012942-99012964 CCCACCCAAGACGGACCTCCACA 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045118739 Original CRISPR GGGAACCGCCGCCGGCGCAG CGG Intergenic
900231164 1:1558798-1558820 GGCAACAGCCGCTGGCCCAGAGG - Intronic
900240774 1:1616235-1616257 GCGCACGGGCGCCGGCGCAGGGG - Intronic
900349814 1:2228939-2228961 GGGCACCGGCGCCGGCACCGCGG - Exonic
907772422 1:57478885-57478907 GGGAACCGGGCCGGGCGCAGTGG - Intronic
910237341 1:85048756-85048778 CGGAGCTGCCGCCGGCGCCGGGG + Intronic
915588792 1:156859325-156859347 GGGAGCCGCTGCAGCCGCAGCGG - Intronic
917345182 1:174022158-174022180 GGCAGCCGCCGCCGCCGCCGAGG + Exonic
917846578 1:179025693-179025715 GGAGACCGGCGCCGGCGCCGAGG + Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
922440734 1:225653268-225653290 GGGCCCGGCCGCCGGCGCGGGGG - Intergenic
1063444078 10:6097516-6097538 GTGAAACACCGCGGGCGCAGTGG + Intronic
1063444204 10:6098726-6098748 GTGAAACACCGCAGGCGCAGTGG - Intronic
1064860272 10:19817736-19817758 GGTAAATGCGGCCGGCGCAGAGG + Intronic
1065343099 10:24724043-24724065 GGGAACCGACGCTGGAGAAGGGG + Intergenic
1072562307 10:96587144-96587166 GGCAACCGCCGCCTGCGCGCCGG + Intronic
1072891675 10:99329975-99329997 GGAAGCCGCCGGCGGCGCCGTGG - Exonic
1073135075 10:101215869-101215891 GGCAAAAGCCGCCGGCGCCGGGG + Intergenic
1073251042 10:102120464-102120486 GGGAGCCGGCGCCGGCGCGAGGG - Intergenic
1073531034 10:104232192-104232214 AGGACGCGCCGCCGGCGGAGTGG + Exonic
1076741177 10:132486466-132486488 GCGATCCGCCGCCGGGGGAGAGG + Intergenic
1077877502 11:6320420-6320442 GGGACCCCCCGCCGGCGCCTCGG + Exonic
1078164473 11:8870798-8870820 GGGGGCCGCCGCAGGCGCAGAGG - Intronic
1082076589 11:47980396-47980418 GGGATCCGCGGCCGGCTCGGAGG + Intergenic
1083610187 11:64000674-64000696 AGGAACCGCCGCCCGAGCCGGGG + Intronic
1084516912 11:69642405-69642427 GGGAAACGCCGCCCGCGCCCAGG + Intronic
1091613972 12:2035128-2035150 GGGCACACGCGCCGGCGCAGGGG - Intronic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1103433026 12:120904104-120904126 CGGAGCCGCCGCCGCCGCCGCGG - Exonic
1106087649 13:26557790-26557812 CGGTCCCGCCGCCGGCGCCGGGG - Exonic
1106568515 13:30906697-30906719 GGGAGCCGGCGGCGGCGCGGGGG + Exonic
1112507199 13:99982138-99982160 GGCAGCCGCCGCCGCCGCCGCGG - Exonic
1113493622 13:110712406-110712428 GGGACCCGCGGCGGCCGCAGCGG + Intronic
1114612521 14:24052102-24052124 AGGAGCCGCCGCCGCCGCCGGGG - Exonic
1117131982 14:52695772-52695794 GGGGACGGGCGCGGGCGCAGCGG - Intronic
1120788094 14:88554966-88554988 GGGACGCGCGGCCGGAGCAGCGG + Intergenic
1122220976 14:100239065-100239087 GGGAAGCCCCGCCGCCGCCGCGG + Exonic
1125535829 15:40440963-40440985 GGGAACCGCGAGCGGCGTAGCGG + Intronic
1127485054 15:59411238-59411260 GGGAACAGTCGCTGGGGCAGAGG + Intronic
1129985803 15:79919159-79919181 GGCCACCGCCGCCGGCCTAGCGG + Intronic
1130076689 15:80695612-80695634 GGCTACCGCCGCCGCCGCCGCGG + Exonic
1131153186 15:90059635-90059657 GGGAGCTGCCGCCGGCACGGGGG - Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132691131 16:1182431-1182453 GAGCACCGCCCCCAGCGCAGGGG - Intronic
1134163958 16:11915573-11915595 GGGAGCCGCCGCCGCCGCAAGGG + Exonic
1134527789 16:14957760-14957782 GGGAGGCGGCGGCGGCGCAGGGG - Intergenic
1135156684 16:20058899-20058921 GGGAAGCGCCCGCGGCACAGTGG - Intronic
1137300672 16:47144508-47144530 GGGAAACGCCGGCAGCGCCGCGG - Intergenic
1137683274 16:50368984-50369006 GGGGCGCGCGGCCGGCGCAGAGG + Intergenic
1140068055 16:71626642-71626664 CGGAGCCGCCGCAGCCGCAGAGG + Exonic
1142188594 16:88706571-88706593 AGGAGCCGCCCCCGGCGCCGCGG + Exonic
1144816622 17:18039652-18039674 AGGAACCGCCGCCGCCGCGCGGG - Exonic
1146176176 17:30667793-30667815 GGGAACCTCCGCCTGCGGGGTGG + Intergenic
1146349634 17:32083904-32083926 GGGAACCTCCGCCTGCGGGGTGG + Intergenic
1147710319 17:42458834-42458856 GGGGGCCGGCGGCGGCGCAGGGG + Intronic
1148462670 17:47847358-47847380 GGGCAAGGCCGGCGGCGCAGTGG - Exonic
1148648131 17:49230758-49230780 CGGAGCCGCGGCCGGCGCTGCGG + Exonic
1151825731 17:76523224-76523246 GGGAGCCGCCTCCTGCGCCGCGG - Intergenic
1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG + Intergenic
1152070418 17:78131435-78131457 AGGCCCCGACGCCGGCGCAGAGG + Exonic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1160453158 18:78979220-78979242 AGAAGCCGCCGGCGGCGCAGAGG + Intergenic
1160967599 19:1753478-1753500 GGGAGCGGCCGCCGGCGCCCGGG - Exonic
1162033037 19:7925570-7925592 GGGACCCGCCCCGGGCGCCGGGG + Intronic
1162953540 19:14085754-14085776 GCGAACGGCCCCCGGCGCGGCGG - Exonic
1166304101 19:41928011-41928033 GAGCGCCGCGGCCGGCGCAGGGG - Intronic
926285241 2:11482772-11482794 CGGAACCGCGGCCAGCGCGGAGG - Intergenic
927698144 2:25251548-25251570 GGGAAGCGCTGCAGTCGCAGGGG - Intronic
933953133 2:87348226-87348248 GGGGCACGGCGCCGGCGCAGAGG - Intergenic
934237364 2:90244571-90244593 GGGGCACGGCGCCGGCGCAGAGG - Intergenic
935622830 2:105144103-105144125 GGGAGCAGCCGGCGGCGCCGCGG + Intergenic
938451441 2:131425007-131425029 GGGAACCGCCGCGGGGGCGGCGG + Intergenic
943669872 2:190649112-190649134 AGGAGCCGCCGCCGCCGCCGCGG + Intronic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
947534770 2:230933708-230933730 GGGGAATGCTGCCGGCGCAGGGG - Intronic
948487208 2:238288588-238288610 CGTAACCGCCGCCGGCGCGCGGG - Exonic
1169213110 20:3778520-3778542 GGGACCGGCCGCCGGCGCCTCGG - Exonic
1173807259 20:45934314-45934336 GGGTTCTGCCGCCGGCCCAGGGG - Intergenic
1175911450 20:62407166-62407188 GGGCCCCGCCGCAGGCGCTGCGG - Exonic
1178915647 21:36704454-36704476 GGGAAAGCCCGCAGGCGCAGAGG + Intronic
954670352 3:52287850-52287872 GGGCACCGCGGCCGGAGCTGTGG + Exonic
958814435 3:98901070-98901092 GGGAACCTCCGTCGGGGCTGCGG - Intronic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
960224000 3:115148047-115148069 GGTAACCGCCGCCTCCGCTGGGG - Intergenic
960628339 3:119703005-119703027 GGTAACGGCCGCCGGCGCGCAGG - Exonic
961832661 3:129632179-129632201 GGGAAGCGCTGCAGTCGCAGGGG + Intergenic
963888935 3:150611928-150611950 GTGAACTGCCGCCGACGGAGCGG - Intronic
964014352 3:151928233-151928255 GGGCCCCGCCCCCGGAGCAGCGG + Intergenic
968575892 4:1365985-1366007 GGGCACCGCCGCCCTCGCACCGG + Intronic
969582198 4:8071959-8071981 GGGAGCTGCCGCCGCCGCGGTGG - Intronic
970195213 4:13544911-13544933 GGCTACCGCCGCCGCCGCCGGGG - Exonic
971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG + Intronic
976431241 4:84966002-84966024 GGGAGCCGCCGCCGCCGCCAGGG - Intronic
979785724 4:124712913-124712935 GGGACCCGCTGCCGGCGCGGCGG + Intergenic
992124491 5:73626458-73626480 GGGAACCGCTGCAGGCGCTGCGG + Intronic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
1002661308 5:180792651-180792673 GGGAATCACCGCCGGCGCGGGGG + Exonic
1008649068 6:53544948-53544970 GGGGTCCGCCGCCGCCGCATCGG - Exonic
1013507599 6:110815351-110815373 GGGAGCCGCCGCCGCCGTCGCGG - Intronic
1017717212 6:157221416-157221438 GAGAACGGCTGCCGGCGCCGCGG - Intergenic
1025992358 7:66505594-66505616 GGGGACAGCGGTCGGCGCAGAGG - Intergenic
1031406911 7:121396527-121396549 GGGAGCTGCCGCCGCCGCAGCGG + Intergenic
1032083172 7:128870002-128870024 GGGAGCCGCCGCCGGGCCGGGGG + Intronic
1036786725 8:11692789-11692811 AGGAAGCGGGGCCGGCGCAGCGG + Intronic
1037886810 8:22599794-22599816 GGGAAGCGGCTCCGGGGCAGGGG - Intronic
1038781262 8:30569972-30569994 GGTAACGGCCGGCGGAGCAGGGG - Intronic
1044698911 8:94949187-94949209 GGGAGCGGCCGCCGGCTCGGCGG + Exonic
1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG + Intergenic
1055611711 9:78031375-78031397 GGGAACCGCCGCGGGGGCGGCGG + Exonic
1057203420 9:93156167-93156189 TGGGACCGCTGCCTGCGCAGAGG + Intergenic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1190007978 X:46758567-46758589 GGGAACCAACACCGTCGCAGCGG + Intronic
1190274568 X:48891690-48891712 GGGGCCCGCCGCGGGCTCAGGGG + Intergenic
1200092490 X:153642452-153642474 GGCAGCCGCCGCCGCCGCTGCGG - Intergenic