ID: 1045124035

View in Genome Browser
Species Human (GRCh38)
Location 8:99070012-99070034
Sequence TACTTGGGATGCCGTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2881
Summary {0: 1, 1: 0, 2: 3, 3: 133, 4: 2744}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045124035 Original CRISPR TACTTGGGATGCCGTGGCGG GGG (reversed) Intronic
Too many off-targets to display for this crispr