ID: 1045130044

View in Genome Browser
Species Human (GRCh38)
Location 8:99140737-99140759
Sequence TTTGTTTACAACTGAAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045130038_1045130044 23 Left 1045130038 8:99140691-99140713 CCTCCTCCTCCTCCTTCTCCTTC 0: 114
1: 1126
2: 5898
3: 11481
4: 21278
Right 1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG No data
1045130042_1045130044 11 Left 1045130042 8:99140703-99140725 CCTTCTCCTTCTTTGTGAGTATA 0: 1
1: 0
2: 2
3: 22
4: 302
Right 1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG No data
1045130043_1045130044 5 Left 1045130043 8:99140709-99140731 CCTTCTTTGTGAGTATACTTTAG 0: 1
1: 0
2: 1
3: 27
4: 193
Right 1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG No data
1045130039_1045130044 20 Left 1045130039 8:99140694-99140716 CCTCCTCCTCCTTCTCCTTCTTT 0: 10
1: 233
2: 1551
3: 5166
4: 14896
Right 1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG No data
1045130040_1045130044 17 Left 1045130040 8:99140697-99140719 CCTCCTCCTTCTCCTTCTTTGTG 0: 1
1: 3
2: 50
3: 500
4: 3469
Right 1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG No data
1045130037_1045130044 26 Left 1045130037 8:99140688-99140710 CCTCCTCCTCCTCCTCCTTCTCC 0: 175
1: 3015
2: 7489
3: 14376
4: 23772
Right 1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG No data
1045130041_1045130044 14 Left 1045130041 8:99140700-99140722 CCTCCTTCTCCTTCTTTGTGAGT 0: 1
1: 0
2: 2
3: 48
4: 538
Right 1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG No data
1045130036_1045130044 27 Left 1045130036 8:99140687-99140709 CCCTCCTCCTCCTCCTCCTTCTC 0: 26
1: 419
2: 1449
3: 3839
4: 9972
Right 1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045130044 Original CRISPR TTTGTTTACAACTGAAACTC TGG Intronic
No off target data available for this crispr